Description :
From Genome Similarity Track
Location :
contig_179:27414- 28513
Transcript NameFunction/comments
g11411.t1hypothetical protein PHYSODRAFT_344027

Sequence
1099 bases(100 bases per row)
CCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTTGAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGA
GAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAGCCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCG
TCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGACGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGGTGTTGCGCTTCCAGTCGGCGA
GGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGGTAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAG
AGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCAGCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCA
TCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAGCTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCC
AGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCCGAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGC
CTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGCCAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTA
ATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCCCAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGAC
CTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGCGGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCATGCTCTCCACGAG
AATGTGTTCTCTCTGCACGCGCAGCTTGATGCGTCCTTCTTCCCACGGCCTCAGCAGCGCGCCCATGCGTTCCAAGAACCACGCGTACTTCTTGGGGAA