Description :
From Genome Similarity Track
Location :
Scaffold_77:27411- 29702
Transcript NameFunction/comments
Phyke_g3243hypothetical protein

Sequence
2291 bases(100 bases per row)
CTTCAAGCAAAGGATTCACTCGTTTCCGAAATCAATATCAGTGAAGTCCTGGAGGTCGCTGAAGGCGTGCGCCAGGAGTACCATGCCTCAACATGGGAGT
ACCTCAAGGTTGCGACGACACTGCTAGCCTTCTTTCGTACTACTGGAAGTGAACAAGACCAGACCAAAACATATATATCTGCGGGTCTTACCCATCTTGT
GAAGGTGTTCTATCCGTACTTGATTAATCAGCCACGCGAAAGGCTCAGTGACAATTGGCATCCTGTGAAAAGTGAGTTCGCCGCTATGGGGATGAACATC
GACCAGCTCTACTTTATATTGGATCCGATGTGTAAAACCCTGCTCCTAGCTGTGAATTTACGCGGCTGGTCGAAGCAaaacgctgaagaagacgatgctC
TTGACGTCCCTATCTTTCCCAAAGTCACTGTCATCTGCGACCGTGACGACGTCTTGCGATCAACCGTGGACTACGTTTCGCACTATCACCTGTCGGTTAA
GGAAGCACTCTCGAACTTTGCCCTCTCCCCGTTCTTCAAGAGCTCTTTCGGCGAGAAAATTGTGGACGGAGTAAAAgtcgaagaaggagaagggAAGGGG
CCGCTGAAGGAATGGTTTGACTTGGTGGGTATGCAGTTGGCGTCGAAGTGGAAAAAAGTACCAATCACTTCAATTCTTTCTGATCCTGACTTGAACGAGG
TCACTGCAAGTGGGAACGCGATCAccattcctgctgctggggaTGTCATTTGTGCTGGATTCCAACTCGAATGGGAAGCTAGCGATGGAGTGGCGATCCA
TCGAGTTGTTAACAAGAGCGTAGGAGATGGCACTTTCCTCTTAGACCGGAGTGTGCCATCCCATTCGTTTCCTGCATCACAGCTGCGCGTCTCACAGCCA
ACAACGGCCTTCTTCGAGTACGTGCAAGGGTCAGAGACCTTTTGGCTTAACGAGAATACTTGTGACTCCCCTAAGAACCGCAAAACGCTGTTTTTTGTCG
GGTGGTTCCTTGCCTGCGCTGTTACGCACTTTTGCTCGTTTCAGCTGAGGATTCACCCTCTATTTTTCCGCATGCTGTTGGACCCGTCGCACTGTGTGAC
TCTGGAAGAGCTGAGGCTATTTAATCCACCGCTGTTTAAGTCCTTGAATGGGATGAAGGAAATGAAGCCGTCAGATTTCGCGGAGTATCTGAAGTTCGAA
GGTGCCGACGAGGGGCTTAGCGTCGAGGAATATATCGACAGCACTCTTGCGGAAAAATTTGGCCCGGAGTCTGGAATTGGATGGCAACTTGACGCTGTAC
GACAGGGTTTTTCTAGAGTCATTTCCATTGAGCAGCTCGGTCGTGTTGGCATGAACGATGAAGATCTAGGGAATATTATTTatggtggcagcagcgatcG
TGGCAGTGAGGATTTCACCATCAGCGATGTTTTTCGTGTCGCCGCGGACTCTGACTTTACGAGCTGTCGGCCCTTGGCGGACACATTTTGGCAGACGGTG
AACAACTTTGAGCCACAAATGAAGCGCAAGTTTATTAAGTTTGTGACGGGTGTCGATACGTTGCCTTTGATGGGCACTGAGGTAAGTGTTAGCGCCACTT
GCTAAAAGTCATTTCGTGAATGACTCACACTTTTGCTTGGTTATGTGATCTCGACTACCAGTTCTTGCGAATAGAGATGCCTTTCACTGCTATATCAGCA
GATGACCACGAGAAGAGCCTCCGAATGCTCCCACAGGCCCACGTAAGTATTTTGTCATATCACTTCTGTTTCATAAAGCATTGGGCGGCTCTGAAATCTC
ACGTGGTTCGCTCCGTAGACTTGCGACAACACGCTCGAACTTCCTCATTACTGGAAGGCTTTATGCTGGAGAGAGCAGCGCGGTGAGCATGAGGCGGATA
GCAATCTTGTAGCAGAGCTGGGGGTTTTGTTGCACAAGAAGCTACAGGACGCAGTGGAATATTCCAGCGGGTACGGGCTTGACGGCACTGCAGAGGTTGA
AGGTGTGTTCGTAAAAAAATCTggaggtgacgatgatgaccaGTTGGTCAATGCCAGCTACGATTCGTTGGGGCTTCCTGCATTGTCGGAACGACCGAGT
ACCGCAGATCCGGTTGCAGACAACTCACAGCCCTCGCCACCGGCGTCAGCAACTAATCAAGAAAACGAAGCTCTTGTAGAAGGCAGCGCAAAGAATAGCT
CTGAAAAGCCAGCCGCTGTTGTATCACCACGCCAGGAAGAGTCTTACGATGACTACGACTgggaggaggaagaagaagagcaatGAGTACT