Description :
From Genome Similarity Track
Location :
Scaffold_94:27410- 28443
Transcript NameFunction/comments
Phyke_g3891hypothetical protein PHYSODRAFT_263134

Sequence
1033 bases(100 bases per row)
GGACGGTGATGAGGAGGACAAGCCTGATTCTAAGAAGGACGATGAAAAACCGAAACCTCAGCCGGATCAACCTGACGAAAAGGGGGCTGATGAGGACAAC
GGTGGCGGTGAGGACGATGGTGACGAGAAGATGGATGAGGAGGTAAACGATGACTTCGAAGACAAATATGAAGATCACCACGACGTGGACCCCCAGGACC
GTGAAGATGGAcatggagacgacgaaggTGAGGAAGAACACGGCGACGATCTGCCTGAAGACATGCAGTTGGATAacgatggtgacgacggcgatgagGA
CGCTGATGCGGAAGGGGATAATCCGGACGATGAAAGCATGGATGCACCGGATGATCTGGAGGACGATACggctgatgacgatgctaCCGGAGAAGACACT
ACTGCTGATggcaacgacgaagaagacgccgagGAAGAAAATGAGGAACCATTGGATAATGCAGTTCAACTTGGGGGCGGTGGCCTTGAAGACGAACCAG
AGCAGgctgaggagaaggatgaagaggagacAGAGCAGACAGAAGCCCCGGAGGCCTCTCAAGAGGAGCAGGCAACGTCTGCAGTGGCAGGCACTCAGTC
TAAGGATGGTcaggacgagctggaggcagAAGAGCAAAGTGCGGAAGATCAAGAAATGGAGGATGCAAACTCCCAGGACCAGGACCAAGAACAAAGTAAG
GATAACAGTAACAGCAACAGGGCGCAACAGCaaagtagcagcaatgatcAAGACGAGCAACAGGAGTGGAAGCCACAATCGCAGGTTGCGAGCAACCCAG
AGCAGGAGCGTCCTCGAGAAAAGCGTCGCGACCGGCATGAACCGAACCCGTACCGGAATGCGCAGGAGGCCCAGGAGCATTGGAAGAAGCGTGTGGAAAT
GGTGGAACCGTCAGAAGATAAGGAGTcagacaacaacagaagTGATaaggaagagaaggcaacggagatgacgacggcTGAGTTTgttgacgacgatgat
gatatGGAAGATGTCATGCATGCTCTAGCTCCT