Description :
From Genome Similarity Track
Location :
Scaffold_228:2741- 4451
Sequence
1710 bases(100 bases per row)
AACCGACGGTACTTATTTCCCAATCTCTGTGAAGAGAAGAGAACCGAAGTGCATCTCCACCCGTGCAACGAGCTGGACTCCCCGTCAATGAGCCGCAAGA
CCTGGGTCGGCGTCTGCCACTGGAGTTTTCGGATTTCTCGACGCGACAATTCTCGAAATTGAGCTCTCTCTCCGTCAAAGGCAAAGTAGGAATTGCATTC
GTTCACGACCAGTTTCCTCCCCGAGAGCAGCGTTGGGTCTTTCACGAATCGAAAAGCGCAGTAGGCGTACAGCATGCTCTTGCTGACCCCAGGTTTCCCA
GTGACTGCGATTCGCGGATGCTTTCCTCAATTTGCTTCAAGAGCAGTTTGAAAAACACAACGTAGCATGGGCGAATGAAAACTTGCTGATCGTCCGTCAG
TTTCTCGAAGAGGACTGGGAATGCCATCGAAAAGCACTTGAAGTCGATCGCCACATGCTCTTCCTGGTCGCCCTCGTCCTTACTTTCGTCACCTTGCTGG
CTGTATCCACTCTTGTTGTTTGACTTGTGCGGGTGGCCTTCGCTCTTACTCTCATCGTGCTCCTGCTGGGCAGCGTGGACCGCCGATATCTCAACAATGA
CCCACTTGCCGCTGTATGCCATGCATCGCCGCTCGTCCGTTCGCATCGATACGCTAGCGATCGGCTCCAAGCTCGTAGGGAACCACTCAGCCAGCGGTGC
GACCATTAAGTCTTCGTCGCCGTCCTCCTCTTGGACTTTCTGTTGTTTGCGCATTGCGGGCACCACTACGACAATTGGGTTGGCCTTCCAGTCGCGTCCT
AGCTCACCGAGTATCTCAGTGGGCTGGAGAGGCGGCTCCTTGTTGTCGAAGGCTGTTCGGTTGCGGTACACTTGGAGACGGACCGTTGGCATTCGCTTGG
CGATCGACGGGAAGCCGTGGCGCAGTTTTGCTTGAAACTCCGCGATCGGGTCTGAACTTAGGAGCTTTAGCGTGCTGAAGCCGTCGTCGTCTTCGTACGG
GTTTCCATCCGAGTCGAGAACGTGGAACCAGACGAGGTGCTTCCCGCGGGGCAGGAAATGTGGAGGCATAGCCATCGAACTGTGAACTAACAAAACCACA
AATGAAATTCCGGAAACGAAAAGTAAAGGAAATCGTCAGCAAAATCACGTACTAGTCAGCGGCGCCTGATGCTTGATGGGGCCAACTGTCGGACTGACGC
GACTGTATCAATCATGGATTGGTGTTTTCATAAACCCATCGACCAAGGGCCATGTGAGAAGAGCACGAGTTGACAAGCGACCATAGCCACCCATCCAATC
AGATTTATAACAAATCTAAATAAACCTCTGGATATGAAATTCAGAGAACTCTTGGGACTGGAGGACACTGCTGCTGGCACTGCTGGTGCCAGCGCCGTAT
CTGTTGCAGCCTCTCGAGGGGAGGGCCTGAACGTCTCGTAGAACTCAATGGCGTCGTCACACGCAGCTGGCTGAGCTTGAACAGCGCTAGCCAGACGCGC
AGCAGCACGTGGCTGCCCTCGCAGAAGATCACGTCCCAGATGCGATGAAGAACGTGCGCACCCGAAGTCGATGGGCCGAAATCTGGCCGGCCACTAAGCT
TGGGATTAACTGTTAGTTTCGTCTTTTCCGTCTTTTTTCAACCGTTACTGTTCGGAACGAGGCCTTATTTTAATAGTGCCAGCGGTCCTACTTTACTTTA
CTTGCGCGGG