Description :
From Genome Similarity Track
Location :
Scaffold_732:2740- 10264
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_732-snap-gene-0.4Oxidoreductase htatip2
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_732-abinit-gene-0.14Tubulin-specific chaperone D
Pytiw_DAOMBR242034maker-piw_contig_732-fgenesh-gene-0.2Phospholipase D; Pi-TM-PLD

Sequence
7524 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCACGCGCCGCG
AGATTCCGGAGAGCAAGTGGGCGACGGCGTTCCCGACACTCGACGTCGCGCAGGCGCAGCGCAAACTGGAGATCCGCGCGGTCGAGTTCAACCAACTGGC
GTCCGCCCACGCGCTCATCAAGGCGGACGAGAAGGTGGACGCCGCGTTTTCGTGCCTCGGCACGACGCGGAAGGGTGCGTTCGCATGGATCTTGTTGATG
TGGGGCTAGCTATTGTACTCTACTTATCATTCCCTTCACTGTCGTACTTGTTCAACAGACGCCGGATCGGCGGAGGCGTTCCGCAAAGGTCCGAGCGTGT
ATAGTAGCAGAGTAGCATGCATGTAGTGAGCGGGCTTATGTGACTGATTGACGCATTACTGTCGTTGTGGACAGTGGATCTGGAGTACACGACGCAGTTT
GGCCAGGCCGCCAAGGTGGCGAACGTGCCGTACTTTGGTCTCCTGACGTCCGGAGTACGGCGCTATCAGCTTGCTGTTATGCAATATACATGCAGACTGA
CGATTGACTCGTGACCGTAGGGCGCGAACAAGAACAGCTGGCTCCTATACTTGCAGACCAAGGGCGAGGCAGAGGAGAACATCAAGAGCCTGGGCTTTGA
GCGCACGTCGTACTTTCGTCCGGGCGTTCTCGAGCGCGGTGACCTCACGCGCACGTTCGAAACGCCCCTGAGTTACGTATTCCCGAGTGTGAGTGGTGCT
GATGCGTGTTCTACAAGTGCGTGAGCGCGAAATCTAAGCCTCTGAACGTCTGTGTGTCGTGTAGATCCTGACTGGCGCAGTGGCCAAGGGCATGGTCGCG
GACTACGAGAGCGGCGTCGCGGGCGTGACCGAGTGGAGCAACACGGACCTCAAGAAGTTCCAACCCAAGAAGTAGGACTTGAGAAGGTTCACCTGCCTGT
GTGGATGCCGTGTTCACATTGCTCGACGGTTTTCTGTCTTTAAGACAACCAATTTCGTAAATGTTATACGCATTTGATGAAGAGCATATCATTCCAATAT
CAACACTGAAGGGCAACGAGAGAGCCATGTATACGACAGGAGAGAGTGCCTGTGGCGGTCGAAGTAGCAGCAGCGCCATTCGAATACGGCAGAGCTCTTG
TCAACTCTCAGCAGCCGAGTCCCAGCTTCGTTGTGCCAGCACTCACTTCTCGACTCCCAGATGAGACGCCACCATCAGTTGAACATGAGCCACTTGAGGA
CTGCATCTGTAGCACTGCCGAGCAGCGCATCGCAGAAGAATCCTCTTCTCTCACTCCAGTCCAGGCACCAGCATCGACCTACTTCACACCCTTGCGTCAT
AACCGGCATGCGTATTTAAACGAGAGAAGCCGCAATTCCTTATAACCGCGTTGACATTATCTCCGCGAATTGTTTGATGTGGACCACACCACAAACACGA
TCCTTCACTACAAGCAACAAGCAAGATGGCGTCGCGTGGAGGTGACGACGGCAACGCTCTCGCTGGCAGCTACGCAGCAGAAGACGCAGCAGCAGACGTG
GATGAAGAGCTCACTGGCGAAGAGAGCTGCTGCGAGAAAAAATTCTTTGATGAACGCGCGCAGGTGGCGCAGCTGCTGCGGGAGCTGCTCGCGACGGCCC
ATGAGAGCGCCGTCGACGCCGCCTTTGAACTCAAGTTCAAGACCATCACAACCATTGTACGCCTCTATTACAACCGCCTAGTACCTGTATACATGTACTG
CTGTGTATCTGACGCGTATCGTGTGTGGGTATGTGTGTTATTAAATGCCAGCTCGACCGGTACTTGGAGCAGTCGCACCTGCTGGACCCGTTCCTGCGCG
AGCTCATCGAGCCCATCATGGCGCAGGTGAAGCTCGTGATCGCAGCCGTGGCGCTCGAGCGAGAGGACGCGCGCGTGGCGGCGCAGGAGGCCACCGAGGC
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGCGTTCCCATTCCAAGT
TTACAAGAACCCCAAGCTGCACAAGCTCTTCCAACTGATCTACCACCTCTGCAAGGTGCGCGGGTACAAGACCGTGGTCAAGATGCTGCCGCACGAGGTG
AGCGACTTTGAGCCGACGCTCATGCTGCTGCAGGCCCAGGACCGCACGGACCACAGCACGTGGGAGACGCGCTATGTGCTGTTGCTCTGGCTCTCGATGC
TCTGCCTCGTGCCCTTCGACCTCAACACCATCGACTCGTCTGTCACGACGGCGGCCGACACGATCAGCGGCAATATCTCGATTGTCTCCAACATCGTGAC
GCTCTGCAAGGAGTACCTGGGCGACCCTGGATCGACCCAGGTCGCTGCCTCCGTGTGTCTCTCGCGGCTGTTGAGTCGCCCAGACATGGAAGCCTACTAC
CTCAACCAGTTCCTCACCTGGTCCAACAACGAGCTCACGATTGCGCACCAGGGCGAGGACCTGCGCGCGAACCAGTTCCGCGTCACGGGCATCATGCTCA
GTCTCGCGCATATCGCCAAGAACTCGCCCCGTGAGCAACACATCCAAGCGAGTCGTATATACTTCAAGAGTGTCATGCAGCTCATCTCGCGCATGACTGA
CGAGGACTCGCGCGCGGATCGGCCGAGCAGCAGCACGCTGCATCGCAAGCTGAGTACGAAGCTGGTCCAGCGCCTGGGGCTGCTGTATCTGCCACCTCGA
GTGCGCTCGTGGCGCTACCAGCGCGGTCTGCGCTCGCTGGAGATGAACATGCAGTCGCTTGGCTTGCTGCCTGGAGGCTCGGGCAGTGCGTCAGCTAACA
CCCCAAAGGAGCAGGAAGACGAGAACGATGTTGAACTGGAGGCTATTGAAGAGCTGGAGCAAATTGTCGAGGTGCTGCTGTGTGGAATTCGTGACAAGGA
CACGGTGGTCCGCTGGTCTGCCGCCAAGGGAATCGGTCGGATCACGGGGCGCCTGCCATACGAATTCGCTGACGACATCGTGCAATCGGTACTGGAGCTC
TTCATCACGACTGAGGGTGACGGCGCGTGGCATGGAGCGAGCTTGGCGCTTGCAGAGCTGGCGCGACGTGGCGTCCTGCTGCCACACAGATTGCCCGAAG
CAGCGCAGTGCGTGGCCCGCGCTCTCCGCTACGACATCCGTCGAGGAGCACACAGCATTGGCTCGCACGTTCGCGACGCAGCGTGCTACTCGTGCTGGTC
GTTTGCGAGAGCGTACGAGCCGTCGCTGTTTCTGCCATGCCTCGAAGAGACCCTCGCGCCAGCGATGCTTGTGAACTGCGTCTTTGATCGCGAACTCAAC
TGTCGTCGTGCGGCATCGGCTGCGTTCCAAGAGTGCGTGGGTCGACAGGGGCGAGCGAATTTCTCCAATGGTATCGATCTGCTGACGAAAGCCGACTACT
TCTCAGTCTCCAACCTGCGTCACGCGTACCTGGATGTGAGTGTCTTCATCGCGAAGTACCCAGAGTACCGCTACCACCTCCTCGAGCACCTCATCTCGAC
CAAGATCTCGCACTGGGACGTGCAGGTCCGCACCCACGCAGCCGCTGCTCTAGGGCGAATTGCAACTTTGGACCCGACATTTGCGATGACGCGGTTGTTC
CCACGCTTGCTGAGCTCTGCGTTGTCCGCGGATGTCGAGGTGATCACTCGCCATGGGGCCACGCTCGCTCTCGCAGAGCTGCTCATGTCGCTCGCACAGG
TGCCCGTGTTCCTGGACGGCGAGCTCCAGAAAGAGCTCAAGATGATGCCGATCGAAGTGGACAAGAAGCGTTTGTTCCGTGGCCGCGGCGGCGAGATGAT
CCGTGCCGCAGTGTGCAACATCATCGAAGTGATCTCTCGCGCTGGCCTGACGCTGAGCTTTGCGCACGTGAAGAAATACTGTGCGATCCTTGAGGAGTGC
TTCGTGCATCCCGTGGAGAGCGTGCGCGTGGCGGCGATCGATGCGTTCTCCGTGTTCACAGCGCAGTACTGCTCTCGAATCTTTGAGAAAGGCACGACTG
TACATGTCAAGTTCCTGAGCGAGCTTGTGCCGCGGTACCTGAACGCCGGCGTGCTCATGGCGACCAAGGAGCGCGGCGTGACCTCACTCACGTTCAACCC
GAACGTTGCGGCGCGACGAGGCTTCATTCGTGCGATCGGCGTGGCCTCGAAAGAATTGCTCCAGCCGTCAATCGTGGATTGCCTGAAGGCGCTGATGCGA
GCAGCGTCGATTCACCAGCAGAGTGCGGACGAGCAAGATGCTGAAAGTCGCGTGGCAGCAGTGCGTGCGATTGTGGATATCTGCTCTCGCTCGAACAACG
ACCTGGACCTTTACAACCTCGAGAACGACATTGTCCACACACTGGTGCAGTGTATTCAACAAGACTATGGCGTGGATGAGCGTGGAGACGTCGGCTCGTG
GGTCCGCAAAGAAGCGATCCTGGGACTGGAGAAGTTGCTGCTTAGAGAGAGCAGCTACGATGAAACCAGGTTGAGCTCACTGACGGGCTTTGCTGTGGGT
ACTGCGTACGGAAATGGGAAGATCACGCGCATTTTGACTGGACCAAGATGCAAGGAGAACGAAGCGGAGGACGACCCCATGACCAACGATCCGGTCTGCT
TTGTGCAGTTTGAGAAGCCAGCGCAGGGCTTCTACTACTTCCCACCCAGCGGCTTGGGTCTCATTCGCCTGAGTAAATTGGAAATCAGCGACCAAGAGAG
AGCCAAGAACGGCGATGTTGCCGCGATGGAGAGCACCAAATTCCAGCTTCCTGGCCTCGGAGATCGCGTGGCATTTATCGAGCAGCACGGAAACAAACAA
GGACTCGATGAACTTGTTTCTGGCGCGCGACAGAAACCGTTTGCGAGACGCATCTCAGTTCATCTCGTGGGCGAATTCGTGAGTATTATCCTGCTGGATT
TTATTGTATCTGTTACTTGTGTGTGGTATTAAGATGTCTAACTGAGCTCTCGCTGTTTATGTTTGTTTGAATTCATCGACAGTTTTGCGAGCTGGGCAAG
CAGCTGGCAGAGAAGCTCGATGGCATGCGTCTCGTCGCCGGCAAAGCGCTCTTTCGCCTATTGCACTCGTCAAACCCACGCGTGGACGCAATCCCAGACC
GTATGCAGTTGGAGAAGCAGATTTTCCCCAAGTCACTCCAAGTGAACTGGTCGATGGCGCACGACACATTCCCGCTCGTCGTGCAGCTCATGGGCATTCC
TGAATACCTCGAATCGGTGACCGCTGGACTCGTGCTCAGCGTCGGTGGGCTCACGGAAAGCGTCGTGAAGTCGTCTAAGGCGGCGCTGTTCGACTGGGTG
CGACGACACGTGCAGCAGAAGAACTTCGGCTTGCTCACGCGCTTCTCGTTCTTCCTCGTGACGCTGCTCTCGCGCCATTCGCAGGAAGATCGCGTGACGC
TGCCGTTGCTCAAGACGCTTGCGATCCTGCTCGAGTCGAATCTGCTGAGCTTTCTCTTTGAGAAGCGCGATGCCGACATGAAAGTCGACTTTGGCGAGAA
ATTGTATGCGGCGCTTCGTGACGAGATTCAGAAGTCGACGTCCGTGCCCAAGATCGCGGCCGCGATCGCTGTACTAACCGGTCTGCTGCCGAGCGAGCCA
GAGACCGAGGGCAAGGCACTCAAGGCGTTGCTGCTCTTCCTTGGCCACCGGTTCCCGAAAGTACGCAAAATGACGGCGGAGAAACTCTACACGCGACTGC
TTGTGAACGAAGAAGTGATCGACGAGACCAAGGTGCGTTTCTGTGTTAGTGGATTGTCTGTGAAGAGCCGTGGCTGACCTGAGTGACGATTATTTGTTTG
CTTATTCGTAGTACGACGCGGTGGTGGAGATCCTGAGCGAGACAGCATGGGATGCCTCGGTACGAATGTCTAGTTATCATTTGTCTGTGGGGAATAGCTG
GTTGGCTAACATTGTGACCGGGTATTTGTGCTATTATAGATCACACAAGTGCGCGAGGCGAGGAACCAGCTGCTGGACGTCCTGGACATGGAGCGACCGG
CAAAGAAACAGTACGAGCAAGACACTCATTGCCATTGCACAAACCGGTCTTAACACTGTTGCTTGTTTGTTTGCATGTTTTCACAGACGACCAGAGGAGA
AAGAAAATGCGAGTGCTGCTGCTGGCGATGCGGAAAGCTACGGCACACTCGTGAAGGAGATGGGGTACTGAGTGAATATGAGACACGGAGATCGTGCGGC
AAGAACCAGAGGAAGAGTATGTAAAAAAAACATGGTGGAGGCAAAGAAGACAAATGCAACCTGGGCTTGCCCTGCAGCTTTGAGCCTAACAACTAACTAC
TCACCGATTGCACCACTCAAGCAGGTCATTCAACAACAGTACAAACAAATGCAACATGGGCTAACGCCAGCACCTCGGTTGCTACCGACGACTCGCCTAA
CAGGCCATAGCAGCGATGGCGTGCGCACTCTTGACGAGGTCGTCCGGATTTTCTTCTTCTTCTCCAAATCTCTTGCTCGCTCTGCGCAACGTGACCATGG
ACGTCTCGTAGGTTACTTTGTGCCTCCCGCCAGTCGCGCCTTCGCTCCCGTAGATGAACACGTTCATCAAGAACCACGTGAGCACGGGACTCCAGTCCTT
CTTCTCGAGGGGCACGATGCAGCAGCGTTCCCGGTGTCGATTGCGAATCCGATCAAACACATCCGTCATTGAGTACTGAGCACCCGAGGTTCCAAAGTAC
ATGCTAAACAGCTCCTGTTGGAAACTGTGGACCGCTTCCCCTTCAAACAGCAGGCCCAGCTCCGTGTCAGTCGGTCTGGAGCTCAGACTGCGGTCCGCGA
GGTTGGATGACGACCGCAACGCATACTGACCATCGACAATCAGGATGTTCGAGTGGACCTTGACGAGCACGCCATCGAGCTCCATTCTGCCGACCACGAG
GTACTCGCGGAGCTCCTGAAGCGAGATTCCGTTGTCCAGTGCGCGGTTCTCGAGCTGCTCGAGGGACCACTGAATTGACAGCGAGCAGTACAGACGCGTG
ACCAGGGAAGGCTCGTCCTGCTGGGCCGCGTTGGTCAAGATGAGCGCGTGGAAAGGCGTCCGCTGGTGATGTGCCCGGCTGATGCGAGTGATGATCGCAT
CGCAGATCCGGTTGTGCTGCATGC