Description :
From Genome Similarity Track
Location :
Scaffold_45:2740- 4598
Transcript NameFunction/comments
Physo_108933predicted protein

Sequence
1858 bases(100 bases per row)
AGCAGCTACCTGTGTACCCCTATCGTGAATCGCTGCTGGAAGCGATTCGGAACTATCCTGTCATTATCATTGAAGGAGAAACGGGATCGGGCAAAACGAC
GCAGATTCCACAGTATCTGCATGAGGTTGGGTACTCGGAGCTGGGCACTATTGGCTGTACGCAGCCAAGACGTGTCGCTGCGATGAGTGTGGCTGCGCGT
GTGGCACAGGAAATGGATGTGAAACTGGGCAATGAAGTGGGATACTCGATTCGTTTCGAGGACTGCACTAGCGACAAGACTGTGATCAAGTACATGACGG
ATGGTATGTTGCTACGTGAGTTTTTGACCGAGCCAGACTTGAAGTCGTACAGTGTCATGATCATTGATGAGGCGCACGAACGGACCTTGAACACGGATAT
TTTGTTCGGCCTCATCAAGGATATCGCGCGTTTCCGTGATGATATCAAGATCATCGTGGCTAGTGCGACGCTGGATGCAACTAAGTTCAGCGCTTACTTC
GACGATGCCCCGATTTTTAAGATCCCCGGACGCATGTTCCCCGTTGATATTCTGTACACGAAGGCTCCTGAGGCTGACTACCTGGATGCGGCCATCGTGA
CAGTCCTCCAGATTCACATTACCCAGCCCCTCGGAGACATCCTCGTCTTCTTTACTGGCCAAGAGGAAATCGAAGCAGCCGAAGAGATATTACTCCAGCG
CACCCGTGGCCTTGGTTCTCGAATACGCGAGCTGCTCATTCGACCGATTTACGCAACCTTGCCTTCGGAACGCCAGGCTCAGGTGTTTGAGCCAACTCCA
GAGGGAGCTCGCAAGGTGGTGCTGAGTACGAATATTGCGGAGACATCGTTGACCATCGCAGGCATCTGCTATGTGATTGATACAGGCTTCTGCAAGCAGA
CGAACTACAACGCGCAAACCGGCATGGAGTCTTTGCTGGTGGCGCCAGTGTCGCAGGCTATGGCAAACCAGCGTGCTGGTCGTGCAGGTCGTACAGCGCC
TGGCAAGTGCTTCCGTCTGTACACAGCGTGGTCGTACAAGAACGAGCTGGACGAGAACACAGTGCCCGAAATTCAGCGCACGAACCTTGCCAGTGTTGTG
CTGCTCATGAAGTCGCTAGGTATCAACGACCTGCTTCACTTCGACTTCATGGACCCTCCACCTGAGAAGGCACTCATTCGCTCGTTGGAGCAATTGTACG
CTCTCGGAGCTCTGAATGGCCTGGGTGAACTCACGAAACTTGGTCGTCGAATGGCTGAGTTCCCGTTGGACCCCATGATGTCCAAGGCACTGCTTGCTTC
GGAAAAGTTCGGCTGCACCGAAGAAGTGATGACGATCTGCGCCATGCTGAGTGTCAACAACTCGATCTTCTACCGACCCAAGGACAAGGCCGTCCACGCT
GATAACGCGCGCCTGAACTTCGCTCGGGGCGGTGGCGGTGACCACATCACGTTGATGAATGTCTACAACCAGTGGGTCGAGACGAACTACTCGACGCAGT
GGACCTACGAGAACTTCGTGATCATGCGCTCACTAAAGACTGCGCGCGACGTCCGAGAGCAGCTCGAAGGCCTCTGCGATCGCGTGGAGCTGGAGCGTAC
GAGCAACCGCAGCGACCACGAGCCGATCCGCAAGGCCATCTGCGCCGGCTACTTCTACAACACGGCCAAGCTGGACAACTCGGGCCACTACAAGACGGTC
AAGAAGGCGCAGTCCGTGTACATCCACCCGAGCTCGTGCCTCATCAAGCTGGAAGAAGTCCCGCGCTGGGTCGTGTACCACGAGCTGGCCTTCACGACGA
AGGAATACATGCGCAACGTGATCCCCATCAAGTCCGAGTGGCTGATGGAGCTCGCGCC