Description :
From Genome Similarity Track
Location :
Scaffold_1389:274- 4889
Sequence
4615 bases(100 bases per row)
TCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAA
GTGGTTCAGACAAGCCAAAGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTT
GCTCGTAAGGTTGGGTGTCAAGTGGATGGGAGTCGGATCCAAGATTGTGGTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGAATCAAGA
TCACGTTGGCAGGTTGTTTGGTGTACTGGTTTGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGAATTCCATGGTACCAGCCGG
AGTGGGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCAAAGATGAGGATC
ATAAGGGCGGATAAGACAACCTGGATCGAGACCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACACGGG
GCGAAAAATAGGTACCTACCGTAATCCAATGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTAGTGGACCATTATGA
GGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTAC
GAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATTCAACTCCGCGAAAGA
TCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACAGGGTCGGTGG
ATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCTGGATCCCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAG
AGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGATCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCC
CCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAG
GCGAGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGA
TCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCACT
GCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACC
TGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCATCCTCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACG
TCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCATCTAATCAACGAGCTGTTGGAAAATTTGGATAAAGTACTC
TGGTACTGTTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTTGGACTGTTC
GAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCCAGATCTACCAACGTCTAATCGATAACGCCCTCTATGGATTCACTCGAATACCGGAACCC
AAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTT
ACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGAAGGCGTGTACTAAGTGGAAAAACTCTATCAG
TGTGGTAAAGAGCTATTGGGGAATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAAGACCTGTCTTCGTTA
GCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCG
CGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGATGCCCACTCCAGCTGTCCGGATAAAAATCCAATAAGATCTGGCCCAGGAGATGCCGGATCC
ACGAAGGAATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACG
ACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTC
ATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGT
CACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTATTGGATCTGAATTACAAC
CTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGGCACTCTCCGTTAGCCTGGCTGTTCAAGTCAGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAG
CTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAGAGGGGGAAGACGAGATCCTGGTAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGA
TGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCT
GAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTACTACGGGCCAGATCCACT
TATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGATTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTG
GGGATTCAAATTTGGGGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGGTCCACCTGCGTGG
TTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTG
GAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATACGGGAAAAGAACAGTCCAGGTGATGGCCGTCA
CTAGATCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGA
AGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGTATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCG
GTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAAGATCGAGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAAC
AGGATGTCCTACACCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACT
ATTCAAGTGTGTACAACGGTATGTCGGGGAATGTGTGGATTATGAGACAGGCAAGGACAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCG
ACTTACCCTTTCCAGATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCG
GATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTTAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGTGCTAGTGAGATAAT
TTGGCATGTTCGGGAGCCAGACTTTATGTCTGACTTCTTTCGAGCCTTCAACCGGATCCTGGGGCAGAGACAGCGGGCGACTATGGCATATCGTCCCCAA
GCCAATGGATCGGCCGAGCGCATATTACAGACGACCACGAGGGCGCTCAAGATGTATGTTCAGGACTTGGGTCAGAGGGATTGGGATGAGTACGCAGAAC
GGCTCCCCTCGCGAT