Description :
From Genome Similarity Track
Location :
Scaffold_773:274- 1346
Sequence
1072 bases(100 bases per row)
CGATGGAGACGTGGTATTAGTGAATCGGTGTCTGTGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAACCGCCCTGTGGCTT
CTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGTTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGC
TCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCGTTATCCTGCGGAAGCTCCGCAGGAAT
CTCTTCCGGGAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGGCTCGTCTTCAATGAGTCCCAGCTCTGCTCTTCAAAGCGCTTCTTCTTAGTC
TTCGCACAGAGAGTGTCCTCGCTCTCAGTGGTGTTCTCCGTGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGTGTCCGAGAGAATGC
ATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACACTTGCGTCGGAGGGTTAGC
GAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCCACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATT
CCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGTAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGTGGAGCCCGGCTCCGCTTGGTTCTTGACCCC
GTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCCTCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTC
ATCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCTTGCAGCGTCGACTCCCGGAGTCGACACG
CCATCCTTACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTTCCCGAGCCGAC