Description :
From Genome Similarity Track
Location :
Scaffold_2:27398- 30330
Transcript NameFunction/comments
Physo_487961chemotaxis protein CheY
Physo_297106Hypothetical protein

Sequence
2932 bases(100 bases per row)
CTCTGTTAACCAGAGCAAAGTGTTCACTGACCAGCAGTGTCAATCTAAGGTAAATATCTACAATGTGAAAATATATATCGGAATGAGCCACTACTAAGTT
ATTAATCATGATGTGCGGTGAATATTTTTTAAAGATGAAGAACATGAAGCAAAAGTGGGCGACTGCGCGGGAAGCAGAAGGTCGAACTGGCAACGACGGA
CCCGTGCGGCGCCCAAATCACTACTCCATCATGAAAGACTACTGGGGTGATGCGACGCGGATGAACAACCGACCGCATATTAGCACGGAGGACCCGGATA
CAACTGCTGCTGCTGGTGACGCTGCGAGCGCCGACGTCGCTGCCTTCGTCACGCCTGCCTCACCTCCCCCTCCTCAATCTCCAACGCCCCGCACCATGTC
TGGCTCCACGGGGTCGTCTAATAAGCGACAGAAGCGCACCCAGGGGGGGCGTGTGGAGGCGGGTTTGAGTGCGGTTGCTAAAGGGTTTAGCGAAGGGCTA
GAAGCTTTGGGCCAAGGACTTGCTACAGTCCGAAATGGGGGTGCCGAAGACATTGCAGCTGCTGTGCAGCAACAGACCGGGCTGTTCCGCGAGCAAAGTG
AGCGGGCTCATGCCCAAACCGAGCAACTCTTGTCGGAAATGCAAGCTCAGAGCGAGCGACTTCGAGTGCAGAATGAAACGATTCGAGAGCTACTGGATTT
GATCCGCCGCGACCATTAAAATCTAGCTACACACGTTTTCTAGACTAGCTCAAAAGCTTCGGTAAAAGCCAAAATGGACTCACGTTTTCTCGAACCAACA
TCTCTTAGAAAGCTTGCAGTCATCTCAGAGTTGTTCCCAGTTACAACAAAATCTTCCTCTTCATCGAAGTTCACCCGCGCGTCATCTTCATCTTCGAAAG
AAGTGTCATCCTTCAAACCCAACAAAATATTGTGGAGAACCATCGTTGCAGCCACAATATCCACAGCCTTCTCGACGCATTTGGTGTTAATGCAGCAGTT
AACAATTCTGAAGCGACCTTTCCAGAGTCCAAAAGCACACTCGACTGTCATCCTAGTTCGGGAATGCAGATAATTGTAGCGTAGCTGCTTGCGTGTCAAA
CCGGCTCCATCATTTTCCATGAACGGCGTCATGATAGCCGGACTAATAGCATATCCTGCATATCCTAAAATGTGGGTCCCCGCTGGCAAAAAGTCTTTGA
AGTTGGAGCCTAAAGTAGACGCACGCCATGTTTTTTGGTCAGACCACGAGCCCGGCCGAATCTCCACGCTAGTAAAGCGCATTTTGTCGTCAACAACAGC
CTGCACATTTAGCGCTGGGAACATCTTTCGACAATAGTATCCCTCAAAGTCCTCGGGCCTGTTAATCTCCACTAGAGAGCCGTCTATCGCGCCCACCACT
CCTGGAATTTCACCTTTCGCTTGGAATTTACCTTGAACTCGGGTCCATTCATGAGCATGCCGCGGAAAATGAACGAACTTGCGCAGCGACCGGCGTAAAG
CCTTGAGAAATATACCAATCACGTCGATAGCCCAGGACTTCGAAATTGCAAACGCAGCCGTAGTTTCTCTATAGCCACCCTGAGAGCCGAGAAAAAAAAG
AAAACAAGCAACCTTCTCCTCAAAAGAGTGCTCCTTCATAAATCGATCTAGCTCAAAAGCTTTCAGCTCCTGACGCAGAACACCTCAAAGCCGTAGAAAC
GTAGCTTGGCTACACCTGAGATTCTGTCGAAACCACTCGTCGTAGACCGCGTCGTAAAGCATAGCCTCAAACTCTAGCGGTGTCAGGGTAAGGATGTTCT
GCTTTGGGTTCGAAATTGCCCACACAGCGGTGTGGACCGCCGTCACGAGAGCTCCCGTGGCCGCAGCAACTGCAGCAACGATGCTTTCGCTCTGCACCAT
CGAAACGCAGTGAAGACGCTCGTCTCCAAAGTGAGACTGGTGATTTAGTCGTCTCAGATTGGTCAGTCTGGAGACGATGAACCTAGCCGATCGAGCTAAT
AACTGGCCAATCAAAAAGAAGAAAAAATGTCGCCACATCGTCTAAGACGATCGAAAGCCGAGACGAGCGTTCCCCGACCAGGCCCTTAACGAATCGTTCA
CCGTGTGCTACACCATAGAAGGGGCGCTCGCAAATATGCCGGGCCATAAAGTAAGGCAATACATGAAGAGAACAGCATTGGAACAAGTACTCGCGGGCGT
ATTTATCCGAGAGAGCCTCGTAGCACCCGGATTTGTGATCTTCACCATTTCTGGGCCGGTGCACCTTATAATTATGGTAAATGTCCGCTTTGGTGGACCG
AGGAAACTGCACATCCAGAACTTTCGCACCACTGAGCTCCGTAAAGGCTCGAGCTAGGGCCGACAAACGCAGTTGACCCCCGCCGCACGTGAAGTGCGTA
CACCCCGTCGAGTTGAACAGCCGTGAAACTGCCAGCATCAGCCTCACTGCGCCTGACTGTATCATGCAGAGTGATGACAGTCCGTTGAATACGGATAATT
GGCACTCCCACACAGCTGCCACACGGCGAGAGTGGAAAACAAAGCCCAAAGTATGAGCCCCATCGTAGACAAACCGCTTCACATCGCGCTACAGGCGGCG
CATCATCTCTTGGCCAATAGTTGTACAGCTCCCTGAACAACTCAACATGGGGCATAGTGGCATTGTGCTCCAGGTTAACTTGCTGAGGGAGGTTCCGTTA
GGATAGCATTAACATGCGCTTCATGGATGTCGTCGAGCATGGCCCGGTGGAGTGGAGATATGGTCGACTTGACGAAGTTGTGCGGGTGGGGAAGTTCAAG
CTCGCCGCGGACGTAAGGAAGGAGGGCCTGCGACTCCTCGGCCGTCATCTCGCGAATATTTTGGCCACGATTCACGTCGCCTGGCGCCAAAGCGACGTCA
CGTAAGCGACGTTCTTCGTCCGTCCACATCTT