Description :
From Genome Similarity Track
Location :
contig_1:273967- 275513
Transcript NameFunction/comments
g98.t1hypothetical protein

Sequence
1546 bases(100 bases per row)
ACGCTATATTTTGCTGCTTCCGACATTAATCAAGACACAAGCGAAGCATTCACCAAAGCAGATATTTCGTCAGTGCTAGCCTCCACTGGGTCACAGCGAT
CTCCAGCCGATGTCACGGAGCAACCCTCGCAGATTGAGGAGTCCCAGCCACCCTCCTCAGACACATTATTGTCGCCGCCGCCGTCACCACAACAATCGGT
CGAGGCCGAACTTAGTTCCACCGCGTCAACAGCAACGGTACAAGCAGTGGAGGCTTTGCTGGAGGTTCAAGCTGCGTCTAACGGTATCCCCACTTTGGCG
GTAAAAACTTTACTACAGGGATACCAAGTTGACTGTGTTTGTATGTCTGTGGTGTTCCTCAGCTCTTCTAGATAATTTGTCGATGTGGCTCGCTGCTGAC
TCAGGCGTCGAAGTGGAGAACCTGGCAGCTTGCTTAGCGTCCTCTGGTGACGACGTCACTGCATGTGGTGTGATCAGGTACGGCTCATAGCCCGATCCAA
ACGTGTCACCCGGTATCACTTACTGATCTTTGTTCAATTCATGCAGTTGGACTAGCCAAATTGTGAACTCGGACAATTATGCTGCAGACGCAATTGCCTT
CCACGCAGCCTCACCACAGCAAAGTACTGTGTGGGTACCGATCGCGCCGGACACTCACAGTCAACTTCCTGCAGTGTATTTCTCGTGCCCCATGGTCACT
GAAACAGGTAGAGTGCACGAGTCGATGACATTGCTTTTCGTGATCTCTCCGGCTCAAATAGTGGAGGTAAGCGATCGCTCACTTGACGAAAACTATAGTT
TGACGCTGACCTTGAATATCGTTTTAATCAGCAGGGCGACTTGTACACCGGGCAGAAGTTCTTTGGGAACTCGCCGTACGGACAATTCGCTCTCCATGGT
GGCAAGCCATCCTTTTACGCCAACAACGGGCTTGTCGAAAGCGACCACGTACTGCCCGTAGGGCGATTCTCGCTGCTCACATACCGATTGCACTCGGGTT
ACGCCGAAATCAAAGTGAACGGCGGATCTTGGGGTGGCGAATCCCCAGTGGAAGGTGATACTGACGAGAGACATGTCCGGATCACCGTGAATGAGGTGGT
GAGCTTGGGCAACAGCAAAAGCGCTTGCGATACCAATGCATTCCAGGGCAGAATTGCTGAGGTGTTGGTGTATGACGCCGTTCTGGATAATGCACAAGTG
GAAGCCGTAGAAAAATACCTCTACGACAAGTGGTGGGGGAACAAGCCGTTCCCAGAAACAGTAGCAGCAACTTCAGAACCCGGTCCTGCAACCGAGGCTC
CACATGACGAGATCGCTGACGTTTTACCGGCACTTAATCCGGACCTCTCAGATCCTGAGCCTGCATCCAAGGCTCCGCATGCAGAGGACGCAAACGGTTC
ACCAACAACCGATCCTATTGATCCGACGGCGATCGAAACAGTGTCTGTTGGGACCTGAAAACGAGCCCTCAGCGACTGGAAAGGCCTTGCAAACATCCTC
GACGGCAAGACAACCGGATGGCGGGCTCACCACTGCTGCGGCCGCG