Description :
From Genome Similarity Track
Location :
contig_1:273954- 275500
Transcript NameFunction/comments
g82.t1hypothetical protein

Sequence
1546 bases(100 bases per row)
ATCCCGAGCCAGTAGTGGTGTCGGAAACCCAGGAAGCTCATTCCCCTGCATCTGGCGCTCCACCTGTGCCGTCACAGACGCTATATTTTGCTGCTTCCGA
CATTGATCAAGACACAAGCGAAGCATTCACCAAAGCAGATATTTCGTCAGTGCTAGCCTCCACTGGGTCACAGCGATCTCCAGCCGATGTCACGGAGCAA
CCCTCGCAGATTGAGGAGTCCCAGCCACCCTCCTCAGACACATTATTGTCGCCGCCGCCGTCACCACAACAATCGGTCGAGGCCGAACTTAGTTCCACCG
CGTCAACAGCAACGGTACAAGCAGTGGAGGCTTTGCTGGAGGTTCAACCTGCGTCTAACGGTATCCCCACTTTGGCGGTAAAAACTTTACTACAGGGATA
CCAAGTTGACTGTGTTTGTATGTCTGTGGTGTTCCTCAGCTCTTCTAGATAATTTGTCGATGTGGCTCGCTGCTGACTCAGGCGTCGAAGTGGAGAACCT
GGCAGCTTGCTTAGCGTCCTCTGGTGACGACGTCACTGCATGTGGTGTGATCAGGTACGGCTCATAGCCCGATCCAAACGTGTCACCCGGTATCACTTAC
TGATCTTTGTTCAATTCATGCAGTTGGACTAGCCAAATTGTGAACTCGGACAATTATGCTGCAGACGCAATTGCCTTCCACGCAGCCTCACCACAGCAAA
GTACTGTGTGGGTACCGATCGCGCCGGACACTCACAGTCAACTTCCTGCAGTGTATTTCTCGTGCCCCATGGTCACTGAAACAGGTAGAGTGCACGAGTC
GATGACATTGCTTTTCGTGATCTCTCCGGCTCAAATAGTGGAGGTAAGCGATCGCTCACTTGACGAAAACTATAGTTTGACGCTGACCTTGAATATCGTT
TTAATCAGCAGGGCGACTTGTACACCGGGCAGAAGTTCTTTGGGAACTCGCCGTACGGACAATTCGCTCTCCATGGTGGCAAGCCATCCTTTTACGCCAA
CAACGGGCTTGTCGAAAGCGACCACGTACTGCCCGTAGGGCGATTCTCGCTGCTCACATACCGATTGCACTCGGGTTACGCCGAAATCAAAGTGAACGGC
GGACCTTGGGGTGGCGAATCCCCAGTGGAAGGTGATACTGACGAGAGACATGTCCGGATCACCGTGAATGAGGTGGTGAGCTTGGGCAACAGCAAAAGCG
CTTGCGATACCAATGCATTCCAGGGCAGAATTGCTGAGGTGTTGGTGTATGACGCCGTTCTGGATAATGCACAAGTGGAAGCCGTAGAAAAATACCTCTA
CGACAAGTGGTGGGGGAACAAGCCGTTCCCAGAAACAGTAGCAGCAACTTCAGAACCCGGTCCTGCAACCGAGGCTCCACATGACGAGATCGCTGACGTT
TTACCGGCACTTAATCCGGACCTCACAGATCCTGAGCCTGCATCCAAGGATCCGCATGCAGAGGACGCAAACGGTTCACCAACAACCGATCCTATTGATC
CGACGGCGATCGAAACAGTGTCTGTTGGGACCTGAAAACGAGCCCT