Description :
From Genome Similarity Track
Location :
Scaffold_121:27386- 30618
Transcript NameFunction/comments
Phyci_286086Hypothetical protein
Phyci_84547GK13362

Sequence
3232 bases(100 bases per row)
ATTTAGGGTCGAGCAGAATGGAGCGCGTGCAATCGTCTTCAGCAGCCGCAAAGTTCTTCATGCGAAGATGAACCAATGCACGATTGGCATAGAGGATCGC
GTCAGTGTCGTCGTATGCCATACTGCGAGTGTAGTGCAACAGCGCGATCTCCAGCTCGTTTGCCTTAAAGCAGTCGTTCCCCTTTTGCTTTTCATACCCT
GCGTATAATTTCCGTGCTTCCGGCTCGAGACTATCAAGCTCCACCGACTTGGGAAGCGACTCCAGCTCCCGTTTCCGAGCCGCTGCTCGTTTTTCCTGCT
CTTCTCGCTGCTGTTTCGCCTGCTCGAGCGCTCGCTCGCTCTCTTCGTCAAGCTCTTCCAGAGCCTTGTCAACGTCGTACTTCTCCCAAGACCTGAAATC
GTACGCCGGGATCGCTTTGGATTTCTTTTCGGAGTTTGCTGGTTTCGACTGGGCTCGCACCAAATTGGACTGCGTGTCCTCAGACGCTTTTTGCCCTCGA
ACAGGCGGCAGCTCTCGCTGGACTGGCGCTTGTCGCCTGAGCGCCTCGTTCTTGACGTCCATCGCCGCAGCCCAGTTCGCCAGCTCGTCGATCTCCGTGG
TCAGCTCGTTCGTGGTCGGCCCTGAGCGCATGCGCAGGATCTTATTGCGCTCTCGCTCGGGCAGCAGCGCCAGGATGCGGTCCTCCGTGGCCTTCTCCAG
GTCGGGGTAGCGGCCTTCCTTGCCCGATCGGAGCGTCGCCAGGATCCCCTTCAGCTCGTCCAGGTCGGTGCAGCGCTCGACGAAGCCGTAGTCCAGCATC
TCCACGTCGATGGTCTTGGGCTTGCGCGTGTGCAGCGCGAAGAAATCCGCCGCGCCGCTGGGGATCGCCATGCTCGCCGGATCCGAAATGCGGATCCTTC
CAGACGGCGTCGCTTTACGTGCAGAGTGATGGTCCTTTTGTTGAAGTTTATTTTTGGCCGCAACGAGCTGCGCCACCTTCTGCGCATTGAAGCGGCCGGA
AACTGCAGGAATATGGAGACGGCGAGGGCTCGCGCTGGCCCCGCAACCGGACGCAGCAGTGCGAACATGGCGCCACCCGCTCCAACCCCCGCCGGGGCTC
GCTCGGAGCACGGCCGCCCGTCCAGACACGAAGACAGCGGACTGATGTCGGACGAAGACGTGCGTTGCCCAGACCCGAACACAATTAGGACCGAAGAGTG
TTGTGGCTGACGTTGGCTCGGTGTTCAACCGTTGCGCTTAGTTCTATGACGCCCACGAAAACATGGAGGCGGACGCCCATCGCCATGCGTCTGCAGGTGT
GTCAAGATGGCTCAGTAACGCAGAGACCGTGTACTACTGCTAGAATCGCTGACATTATGATTTTAACTGTACAGCTTCAAATGCAGCGACGAACCAGCAA
TCGCGAGGCCCTGAGCTGGAGACCAAGCCGAGCGACCCGGACGACAGCAAATATATTGTGAAGAACAAGGACACGGGCGAAGTATTCGACATCCGCGACT
TGGCGAGCATGCCGGCCAACTCGTACTCCATTTTCCCAAACAACTTTGTCGCTCCACAGGAAGAAGAGGTAGGTGGGATATGAATTGCATTGTGAAAGAC
AACGGCTCCGCTTAGTTCTATGCGTGTATGCAGGCCAAGCGAACCAAAACTAGGCGACCTTCGCTGACCAAGATCATGGCTAAATTCCCGATCAAATCCA
AGGCGAAAGAACCAGCAAAAAAGAACCATGTTCTGGTACTGCTGCACAACCAATTTTTTTTTCACTTTCGCTGACTGGGGAAATGTTATCGTCTTAGGTG
ACATGTTGCAAAAAGGAAAAGCGAGACTTTGAGGATCTATGTCTGGCACAGACATTATCGAAGCACACTGGCACCATCTGGACGATGAAGTTCAGCCATG
ATGGTGCTCGGCTCGTGTCGGGAGGGCAAGACACCATCCTGCGCGTTTGGAAAGTTCAAATTAGCTCTGAAGAAGATGCCAAAGTAGCGAGAGAGAACGA
TGAAAAACATATCCTTGATGCTGAGCCAGAGAGGTCCTACCAGGTAAGGCTACGCACAAAGCAACTGCTATCTACCTAGCCTGACGGTTAATGTTGCCTC
AGGGGCACACAATGCCAATCGTGGATGTGTCTTGGAGTCGCAGCAACTTCATCCTGTCGGCATCAATGGACAAGGTCTGACTTAGATCTACGCGTACACC
ATGATACTTTACGATACCTGACCCTGATACGTGCTTGCTATTCCAGACGGTTAGGCTATGGCATATCTCGCGCGAAGACTGTCTGCATGTATTTCATCAT
CCTGATAGCGTGCCTGCGGTGGACTTCCACCCAAAGGTTTGTTGACTCGATCACTGGTGAGGCTATAAACCTTGTCTGATAATCATGCTGCAAAACATAG
GAGGATCGATACTTTTTGTCGGGGTGCTTCGACAATAAAGCACGCGTTTGGGATATCCCAGACGGTTGTGTAGTTTCCTACGTTCAGACGCCAGTGATGA
TTACTGCTGCCAGCTTTAACCCCAGCGGCACACGCGCCATTGTTGGCTTACTGAACGGGCAATGCATTTTTTACCAAGTCAACTCGCACCAGCAGATGAA
CTACTACACACAGATTGAGTGTCGAAACAGTCGTGGGTCAATGAGAAAGGGACGCAAGGTCACAGGTATCGAGTTTGATCCTGAGGGCAAATATTTCCTG
GTCAGCACAAACGACTCGCGCATGAGACTCTTCTCAGTCGACAACTATTCCCGAATATGCAAGTATAAGGGCCTCGTAAATGGGCACCTTCAAATCAAGG
GAAGATTCAGGTATGGCGATGGCTTTGTTACGCTTATTCGGATTCCCTACTCCTCACATTGTTGTACATATTTCCAGCCAAGATGGCGACTTCGTAATTT
GTGGGTCAGAGAACGGTTCGGTCTACGTTTGGAACAAAGCAAGGTTTGTGCTGCTCATTTATCGAATGATTGGTGTATTGCCTAAGACTTTCATTTGAGC
CACAGATACCTCAAGTCTATGAGCATCGTCAAAAGCAGCAAGCAGGATCGCAATTCCTCCTACGAATTTTTTACAGGTACAGTTTGCAAAAGTTGATGCT
AACAGTGAGAACTTGTCCTTATATTCATTTAAATTATGTCGTGCTATAGCTGCCGAGCCACCAAATGGTATTGTTACGGTTGCACTGTTTGCACCGGCGA
GCACGTTCGCTATGGTGAAATCAAAGCTAGAG