Description :
From Genome Similarity Track
Location :
Scaffold_89:273823- 275795
Transcript NameFunction/comments
Hyaar_Emoy2808858ankyrin repeat domain 52 (predicted)

Sequence
1972 bases(100 bases per row)
CTGTGATCTTGGCAAGCCTTTAAAGATCACGTTCCAAGCTCCTGCAGGACATAGTCTCCTGGACCGTATCCGCGTGGTTGACATGAACTCGGATGTGGCT
CTTTGGCTGCAGGTCTCCAAGACCTTTAGTATTCCCGCCGGTGATGTGGGCTCGATCACATTAGATGTCGAGACGCTGGATCGCCCGTCGCTTTATCGTA
TTGTGTACGAGAAATACGAGCCGATGCCTATCCATCAGCAGCAACCAGCAGACTCGGGCGCTGACAGTAATTTGTGCGTCAAAAATCTGGATACAGGAGC
GACACTGTCGATGGGCAGCGTCAACACGTTGGTCTTAAAGGAGCTCAATAGCTCTCGATCATCGAAGAGTTCAACAAAGCTGTCGAGTTCATCCAGGTAC
GCAAATGTCAAGGTGTTCCTTGACCGGTATGGAGTACTGACAATCACTGTGTGTTCACTATAGACCAGCGCCCAAATCGGACAAAGCTGCGACCATGGTG
CGACGAGGATCGACAACGTACGTCTTTACTTAGCTAAGCCATGCTGCGTAGCATGTATTGTCGATAGGTAACTCAATGTTGTTATTCATGGTAACAGTCG
AGCACGCGAGATCACTCAAAGGGTGTGCGAAGCGACCGTAGAGGAAGACGATGAAGAAGAAGACAAAGATGCTGACTTCTCAGCCGGTGACACGCTTACA
GCGCAGGTGATTGCGGAGCACCCAGCGGTGACGAGTATTACGGGCGTATACAAAATCGTAGCCATGGGGGCTGTCAGCATTTCAACGATGAGAACTGCCA
AGGCGAATGAATATGAGATCGCTATCCGTGATAAGGGCCCGCTTGGTCTCCAGTTGGTACGGTTGTCGTCTTGCTGCTCGCAAAGCCTCATGCGCCATTG
CATCTGATGACCATCGTTGTTTTGCGTGTGCAGGCGCCAAAAATCGATGGTTCGAAGAGGTCCCCGCGTCTTATTGTACGACGGAGCCAAGGCCAAACGG
CGGCCGTGAATCCAGGTGATTGTCTTGTTGCAATCGGTAACGCAAACATTGAGCACGCTGGTCTCAAGCACACGCTGTGGGCACTGAACGACGCAAAGCG
GCCGCTCGTCCTTCGCTTTCGACGCGGAAATGCGAAGGAGAAAAGAAGTTTGTTTACGGCCGGTCTGCTTAAGTTTACAGGACCTCATAGACATCCCATT
ATTGCGGTGTAGTCAGTCGGCTAGGTGCAGCTTCTCGTTCCGCTAATGAATTTGCATTTCTTGATGGGGTTGGCCCATCAATAGTGCGAATCGATTTCGA
AAGTCCGCTCGCTCTACAAAGCAGTCAATCTTGTACATAACAATGTAAGCTCGTCGGCTCACAGTGGCGAAGCTTTACTGCGCTACAACATGGGATGTCC
TCTGTCTACATGACAATATCCAAAAGTCCTGTTTCGGCTAGCACATCGTGTGCATAATGCTCCGGGTTTTGTTGACACGTCAATAACATGCAGCGGATGT
GTCTACCCATAAATAAGCAAAAGTCAACACGTCAGACACGTCAGACACGTCATACTTATGCAAAGAGCACAAAAGAAACTCACCCTAAAGTGTTCAATCA
AATCACCTGGGCGCACGTGTAAATGAGCCTCTGTCTCGGGATCAAACACGGTTGCCGGATCTGCAACAGCAATCGCGTGACAAGTAGTAATTATCTGAAG
ATGTCACTTAAGCTGGGGCAAAAGGTCTCTTACATTGCTTGCCGTCACCGCGCCAAAGATACCAAGCTTGCGCTTCCCACCACGCTGGTTCTAGACATCC
TGCGTTTTTATACTATTCGTTCAGTGACATCGAAACCACATCGTCAATATTAGCATGGTAGCCCGCCTATGTCAAAGAAAGAAATTATAAGACATAGCAA
CTTACGGCGATCGCTAGCAAGGATCCAGGCCGTAACGTGCTCGCCCACGACTTCACGTGCGTTAAAAAGTCA