Description :
From Genome Similarity Track
Location :
Scaffold_40:27376- 31358
Transcript NameFunction/comments
Physo_157250PsSNEL5
Physo_157252AAA family ATPase, CDC48 subfamily
Physo_157253hypothetical protein

Sequence
3982 bases(100 bases per row)
GATAAGCATGCGCGCTGCTAAGCAAGTTTGCTCTAGGCCGCATCACCGAACAGGCTCTACCAGATCTGATCTAAAATGATACCTTTTATCAAGGCGATAC
TTCGATTCTGTCGGCAGGCTCTTATGGCAATGGGTTTAATTTCATGCACCAAAGCGTCGGGCATCCGCAGCCTTGCGCCGTGCTTGGTTACTGCGAATCG
AAGCTCGAGGGCCATCTGAACGCCTACTTTTGTCTCTCGTAGAGCCGGTATTTCGGCGAGCAAAGAGTGGTGTTGCTGTCGCTGACTTCAATGCGGTCGA
CGATGTACCGGTAGCTTCGTCCAGGGCCTGCAGCACGTACTTGATCGACACTGCCGTAGCCTGCAGATCGTCACGCATCGACGCCATGGCTGCTTCGCGA
AGAATGGCACTCACGTCGCCCGCGGACAATCCGGTGGTACGCTTGGCCATGTGTCCTGCTAGTACCTCGCGAGAATCGAATGCTGGGACGGCAGAGTAGT
CAATAAGAACCTTCTTCAGAGCCTGGAGGATCATCTCACGCCGTGCTTCTTCATCCGGGAAGTCAACCTGGATGTGAACATCGAAACGTCTGCAAGCATA
CAAGTTAGTTGTGCCACGTCCACACTAACACAACAGCAGCGTACATACCCTGGTCGAAGAATAGCGGGATCAAGAAGTTCCTTGTGCGTTGTGGAGGCGA
GAATGACAACGTGTTGCTTCAGAAACTCCATGCGCGCCTTGTCACTCGCTAAGCTCCGCTGAAGCTTGGTCCGGCTTGTGTTGAAGCCATCCATTTCGAC
CAGTAGCATACTGAGCATACGATCAAAGGTCTGCTCAGTACTTGTGTCAAAGCCTCGCACAGGCGCAATGCTCTCGATTTGATCGAAATACAGCACACAA
GGCGCTGCATTTCTGGCAGTGGCAAAGAGCTCGCGCAGAGCCTTTTCGGTGTCACCAACAATCTTCGTGAGCAGGTCGCTGCATTGGACAGACACGAAGG
AAGCGAGACCACGGCGACGGACTTCTTCAGCTACCGCGTTAGCCAGGTGCGTTTTGCCAGATCCTGGCGGTCCTGTTAGCAGCACACCTTTCGGTGGAGT
CGTTCCAAACCGCAGAAAGCGGCTACAATCCTCCAGCGGCTCTATCATGGACACTCGTAGTGTTTGGATAGCGTCTTTCATACCGAAAACACCCGGGAAA
GAACCGGAAGACGTGGGTTCGCTGTGCTTTTGAATCGACGTAGACACCGGCTGCTGCTGCTTTTGCGAGACGTGATGCGTCTGGAGTACAGACGGATAGG
TCACTGCAAGAGCCAGCTCAAAGTGGCGTGGGCAAACCATAGCTCTGTCCTCGGATTTTGTGGCCGCTGCCTCGTTCAAACAGTACTGCAACGTCTTCTG
GCAAAGGCTCAATAGATCCGCACCAACGAATCCACCAGTGCTTTCGCTAAGTTGGTCCAGGAATCCATCTTCAAGATTGTCGCCCTGCCACGTCCTCGTC
ATAATCCGAAGAATCTCAAGCCGTTCGGTTTGAGAAGGAGGTTCGATCTTCACAATTTGATCGAGTCTTCCGTTCGAAAGCACCGCAGGATCCACATCTC
CAGGGCGTGTTGTGGTGCTCAACACGAGCACTCGGTGCGACGACGCCTTGATCTTCTCCAGAGACGACAGCAGCGCACCCAGCACGCCAATCTCCAGAGC
ACTCTGCGAATCTGCCAAAGCGCGCCGAGAACCAGCAATCGCCTCAATGCCATCGATCAGCAGCACGCACGGAGCTTGCAGCACCGCCCCTTCAAAGATC
TTGACGAGCTGCTTCTCGGACTGACCAACGTACGTCTGGAAAATATCCGCTGCATTGAGGAAAATCGTCTTCACCCCGATAGATTTGCAAATAGCCTGTG
CTAGCGCAGTTTTGCCGATACCCGGCAGGCCACTGATCAGTGCTCCGACACTCGGTTTCACGGTCTTCATTCCTTCCTGCTCCGATCCAAGCCGCTGCAA
AATCGTCTGCAGCAGACTCCTCGCGTACTTTTCCACTCCTCCAAGTTCACCTGCAACTTGCTCCACATACACATCAACCGGCTGGAACGCTGCCGCGTTC
AACCCGCCATTCGGCTGCTCATCACCGACAAAACGCAACTCGATTCTGGAGGTGCTCGATGAAATCGTAGCGAGCTGCTGGCAGCACCCCGATCCTGTGC
ATTCCCACTCGACCTCCGAAAACTTGACGCGTTCTCTGCGGTTCAACCAAGTGACTGACGATTGTCTGCCAATCCACACCACCGCACCGTCCAGCAGCTT
GGCCGCAATCCGCTGCAGCCCTCGGACCACGGCGCTGGGAGGTCTCGTCCGATCCAGGAACTCCACGCGGACGCTCGCAACGACGCCACACTTGCACTTG
CATTTGGATTTACCAGTCGTCAGCTCTTCATCAGCTGCTGACTGCACTTGCAACGCCACGTGCTGGCCTTTCGCGTCGCTGGGCAGCTGCAGCGCCTCCG
AGAGCCCGAAAGACAGCGACGAAGTCTCCGCTGCACCTCGCAGCTGCGCGAGCGCAACGCTCTCTCCATAGAGAACCTTCACGTACTTGTGCCCGCGTTG
AACAGCGGAGCTGTAGAGCACGCAGCGCTCGTCCGTGGCCGTCGTCACAGCGGACGCAGCGCCGCCCACCACCACATTGACACACTCGGCCGCAGCCATG
TCTTCTATGATTGCAACGACAGTAAGTAACATAATACAAAAAGGATGTGGTACACATCAATTGCTTTTTAGCGCTACTTCAGCAGTACTCTGCTCTTCTC
TTCCCTTCATCCTTAGAGATGGACGTGTGGTATGTCACTACGCAGTACCCCAAGTACGGGGACAGTCCGCCCTACGAGACGGTGAGCCACCCGGCCGTGT
CCTCCTACTCCCGGCCCTTCTCCATGCGCGTGCCGTGCGTCTACCTCGTCTGGGACTCGAAGCTCGGGGTCATCGCGCTGCGCCGACGCGAGCGCGAGCG
GCAGCTGGCCGTGAGTCGCTGCGGCTTCGTGCTGGCGGGCGTCTACTTCCAGGTGGACCAGGCCACGGCGCTGCAGATCCCCGTGGCGCTCAAGGTCATG
GACCGCGCGCAGGTTTTGCTGCAGCGGGACGACGTGGAGAGCGAGATCCGCGTCATGGGGCAGCTGCAGATGGCCGGCATCGACGCCCCATTGGCCAACG
AGTACATGATCCGCTGGGAGTACGCCAGCGACGCCTACAACCAGTACGTGGCCACCGAGTACGTGGCCAACGGCAGCCTCCAGGCCTACGCGCACCGCCA
GGTGCACCAGTTGATGTTCAAGCACCTGCAGGAGTTCGCGCAGGAGCACGGGGCGGCCCCCACCAAGCTCGAGTGCATCTCGTACGTGTATCGGGGCAGC
GGCCACGAGTGGATGAGGGAGGGCGTCGAGATCTTCAAGGGGATTGTTCGGGCGTTGACGTATCTGCACGCGCAGAACGTGGCGCACCTGGATCTGGACG
TGTACAATGTGGCGGTGGACGGACGCACGTGTCCGAGGATTATCGACTTGGGCAGCAGCCAGATCATGGACAATAGAGGTCTTGTGGGGGCCGGGTATGT
TAGCATCAAGTGCAAGCCGCTGTTCGTGTCGCCAGAAGTGAGGTCCCATCAGAGGATGGCGCCACCGAGGCCGGGCTTCAATGGCGCCGCGGCGGATATG
TGGGCGGCAGGGGTTATTGTGAGTTGAATTGGGCTTTCGCGGTAGTCGGTTGTGTGGACTGACGGTGTGTTTGTGCGGCTGTGTGATTTTTAGCTGGTGC
AGTGTATTGTGTGGGGCTTCCGCGGCGGCCCCTCGTATTTGGTGTCCAACACGAATTGGCGGCGAGAGGTGTTTAACCATATCGACGCAACGTGCAGTCC
GAAGACGTGCCATTTGTGCGTGAATTTTATTTCCATCCCGCCATTGATCGGTGCGATTATCAAGCAGTTGCTGCATGTGGAC