Description :
From Genome Similarity Track
Location :
Scaffold_19:2737- 6742
Transcript NameFunction/comments
Phyra_76569AlNc14C109G6335

Sequence
4005 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCATGATCATGAGCACGAGTGGCGTCAAGTACGTATTGGTCCTTAAGGACGGAATGAGCGGGTTC
GTCGAGTTGTTGGCATGTACGCACGCGACATCCGACCACGCGTACCAGGGTCTCATCGATTGGTTCAAGCGTTTTGGCGTTGTGCATCAGTGGGTCTCCG
ACCAGGGGGCGCATTTTCGGAACCAAGTGGTCGAACGCCTGCAACGCGCCCTGGGTGCGCACCATCATTTCACCACTGCCTACACGCCGTGGGCGAATGG
CACCGTCGAAGTGGTGAACCGAGAGGTTCTTAAGAGCGTGAAGGCTCTTCTAAGTGAGCGCAGGATGCATGTTCAAGATTGGCCTGCAGTACTACCGGTG
GTGCAAGCGGCGCTTAACGCTATGCCCGCGGACAGGCTGGATGGCCGCTCACCCCTGACAGCGTTCACAGCGTTACCGGCTGACTCCCAGCTTCGCAGCA
TTTTGCACCCTCGATCTCCAACGCAGGCAACCCTCGAGTGGGTCGACTCGGAAGTTCGCAGTCATCTCACCGCTGTTCGCGAGGCGTTGGATAATATGCA
TGCGGAAATGGTGAGTGCCAGCGAGAAGCGCCGGCGTGCGGCGCGGGAGCGGCATGCGCGTCGCCAAGGTGTGCGGCTTCACAAGTTTAGCGAAGGTGAT
TTCGTCCTGGCGGCGACAGCAACTGGGCGCAGTGGGCACAAACTGGCCTTGGTGTGGCGCGGCCCTAAGCGCATCCTCAAGGCGCTGAATGACTACACTT
TCGAGGTCCAAGATATTATCGAGCCATTCGCTGTCACTATCCGCCATGCCTCCCGACTTCAGCTTTATCGCGACGCCGCCCGTGGGCGCGTGGAGGAGCT
CCAAGAGCAGGCAATCTACGGCGAGGGTGGACATCTGGTTGAAGCGCTGCTCGACTGTCGGCTGAGCCCGGACTCGCACCGTTGGGAGGTATTCGTCAAG
TGGTTCGGTCTTGACGACATCGAGGCGTCATGGGAACCAGCCGACATCATCAAGCAGGATGTGCCGGGCCTTTTTCAGGTTTTCGTCGACGACCAGCCTG
AAGCTCGGTCCCGCCGCGACATGGCGGCCGCGTTGGCGGGTCCCGACCGCGATGACGAACGTCCAGCCCAGCGTGCCCCCCGCCGACGCCAACCGCGCCA
GCCGCGACCCTGATTACCGACTTCACGTGGAGGGGGAAGTGATCCGCCGGCTGCTCCAGCGGAACCCTCCTTCTGGCTCTCGGAGGCTACAGGTCTTTAC
ACGACTGATCAGGCAAGACACGACGACTCGACCAGGTTGGCGACCGCGCCGAGGTACGTAAAGGAGAAGAGGTCTAGGTAGGGCAGCGAGCAGAGAGAGA
GAGCCGAGCTAGCAAGAGGCTAACCGGAATCGAACTCAGTTTTTGAATTTGCTCGGTAGAGAGCTTTCCGTTGGAAACGGATCACTCCTGACGATGGTAG
TTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGC
CCCCCGAACATGATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCAAGCGACACCCGCAGCGGACTACAGCAACGTACGTGTAGATGCATATATATA
TATATATATATATAATAAACCACTTTTCGGTTTCGGGAGTTCCGCCTGTTGGGATAACTGGTACCTCCAGGGCAGTTCGAGGATATATTCGCATAGAATT
AGGGGTAGCCTGGTGCCTATTTAGGGGTCTTAGGACCCTTATTTGGGAGGCCCTGGGTTGTTGTAGCGGGAGCCGCGCCACGACCACATTGTCGAGACAA
CCCAGCGGTCGCGTAGACGCCGGACAGTCGCTCTGAAGCCACAACAATATTATTGTATTATTTGTATCCGATTTAATTATTGGGTATGAAAGTACTATAG
TACTGTGGATTTTATGCACTATATCCGTTACTTTCCTTTGTAAAGGTGTTTTTAACACTTTACTAGGATAAGAAAGGCTGCAGCTGGCACCCGCCGCCGT
ACTAAGACTAACCTCGCCGCACCCTTGCTCTTCGGAGCCGCGACCCTGAGGCGCCCATGTTCGCCCGTCAGCGGCATGGGGAGTCTCATACCAACCCGGG
GTAGTGGGGCAGATCCATGTGGCGATAAAAGCCGGTTTTTACCGGGCCGCCTTCCTCACTCTCGGACCAGTGGTCTGTGTATGGGGCCGGGCACTTTGGA
TAGAAACATCCTCAGTTGCTTCTGTGTCCGCGGCGGGGGGCATGCGGCCAGACACATGGCATGGGCATAAAACCCAGGCCGATTCACTTTGAACAGTGAC
TTGATGGCTTATGGCTTACCTTTTGCACATGCAATTGGAACCGCTTACCGCATGTTAACAATCCAATATAGGGCGGCTATATGCTATTCGATTGAGGTGC
CTGCTGCACATACAAGGGCTCGATTCATATTGTAAATTGGTCAATTGCATGCAATATAATCTGTAATTTCTATATTTCGGCTGTAAGTCGCGGCTTTTGC
GATCCTTCAATGCTTATGATGCAAGTGGAAGTTCCAACTAAAAAAAATAGGGGGAAATACCCCAATAGCTTTCCCATAACCCCTTTACAACCAAAATGGT
TAATTGCCTAAGTTGAATAGACTTAGTGGCATTAAGCAGACGCTCACCCACGGTCACCAAAGGAAGTGACCACAACACGTGTGGTGAGTTGTCGCTTCGG
CACTCAAAAGAAAACTCGCCGCTCCCTCTCCAGAGGTATTGAGATGGGTCTAAAAAAAGGCGGGTCGTGCTTACAGGAGGTAATTGAGGAGTTGAGGGAA
GAGAAGAAAAAAAGGTTGGTTCGGAAGCGGCTATATGAGGCGTTTTACTGTCGCTTAAGCTGTGATTTGTAGCTGGGATACATGATTGTCGCGGTTATAT
TGCGTATATGCGGTCGGTTTCAGATGTTTCGTGCTCTTCGTGGATGCAGTCATCATTTTGTCGGGTGGCAAGCGGTCGCTCACGTAGATGTAGGGCGGGG
CGGAC