Description :
From Genome Similarity Track
Location :
Scaffold_2475:2737- 3803
Transcript NameFunction/comments
Phyta_totarag14531hypothetical protein

Sequence
1066 bases(100 bases per row)
TGAAGTCTCAGCAGTCTCAGCCAGTGGAACCTAGAAGTGTTCTTGGCTCTGTTAGCGCCGACCGGCACGCAGCGGACGGTCGGTCTCGTGCTCGTGACGC
TCCGCGTCAggcgccttcgtcgtcgatgtccgCCGCGAACCGCTGTGGGACCGAGCGGCCCCCATGCGGCGACGGAGAGTTGTCAGTCGCTGGTCGAGGC
TCAGCAGTTGGACCGCCTCGCAATGCGCGGTcgcttgcagctccttgagtcTCGGGTCGATACGGACCGGCTCCATGCGCGAGAGACGCACGACCAGGAA
GCAAAGAGCTTTCGGGACCGGTTGGATCACCTTGAGAGGGAGCAGAGTTGGATCGACGACCGTTTCGCGCGTGTGGAGCAGTTCGGGCAGCGCATCAAAG
ATGACCTAAGCAACCACCGCGGTTGATTGTGATCGTTGTACGACCGCGTGGCCAGGCTGGCGCAGCAGTCCCACTCGAGGACGGCGTTGGTATCTGCACC
AGAGCCTCCGACGGCCCCTTCCTCGGCGCTCGGAATGGCACAACCTCAGGGTGACCTACTGCAGAGGGAGATGCGGGACGCTCTGCGTCAAATATGCGGC
GGGACTCCCGGATCCGGTGAGCCAGACTCCCCCGGCGAACGATAGGCTGCGAGCAAGCCGACGTAGAACGTCGGGTGTCGCCATTGTCGATGGCAAGTCT
AGTGTGTACGAGTTGGCGCGAACCCCAATGACCGTGGATGGTCCCACATAGCGAAGTCGGAGCTTCGTGCTCCACACCGCGGACACTGCACGTGTAGGTA
GGTTCTTCGCATTCAATAAAACCAAGTCTCCCAGACTAAACTCTTGTGTGTTCGTTCACCCATGGCGGTCACTGTTCTCCTTTTGCACTACTGCCATGGC
GTCTCGGACGCGCTGGTATATCGCCTCGCTCTCCTCTATAAATGAGAGAAGGTTCCGTTTGACGGATGCCCGCACTCCGTTGGGACCCCGTGACAGCCTA
TCCCTTACCCAaaccagaagctggtggcaaCACCAGAGGCGTACGCGGGTGTCGCAGCCCATTCAC