Description :
From Genome Similarity Track
Location :
Scaffold_70:273640- 274816
Sequence
1176 bases(100 bases per row)
AACAGATAGTCCGCATCAACTGCAGGCTCAGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGATCTATCTAGTTTAAATGGCTTCC
ATACACCGGGCTTTGCAGCTCTGGCGACAGATCCTTCTTGTCGACGTTGGACTTCAGGAGCTTGGTGAGCTCGAGGAGTGCTTCGCACTTCCCAGCGTCG
TGCACCTGTTTGCACAGTTTGCACCGCCGGTAGCAGAAGTGCACGGAGTGGGACGAGCTTCCGCACGCGGCACACGGTCCATACTGGCGACGGCCATCTA
GTTCGCGGGTGGATGGGCCTCCTCCGTTCCTGAAGTGTCGGTTGTCAGACCGGCGAACGTTCCATCGGCTGCTGCTCTGCGCTCAGCATCGTTAGCGACA
GCGACATGTCCAATAGACTCGTCCGAGCTATAATCCGCCTCTGAGTCCTCGTTCGAACGTTGGTCGTCTGAGTACTGGCGCTCGTCCTCGAAGTAATCCT
CGTTCGCCTCAGCGTCACGTCGGGGGGCGTACGAAGCTTCGTTACGTGCACCGACCGAGCCTCCGACGTTCCATTCCGCCACCGCATCGGCTAGCGCGTC
GACCTAAGTCACTCGTGACCGGTACGGTGATCCATCGCGGCGGTCCCGGTGGCGGTCGTCCTCGCGACAGTCGTTGCGGCGGTCGTCGTCACGGTAGCGT
TGTTGGCGTCGGTAACCACTCCGAGAATCCTCGTTCGGCCTCGCATCACGTCGGCGACCGTCATCTTGACTCCGAGAGCGGCGGAACGACGACTCAAGAG
TTGACTTGCGATCGCGGTGACGCAAAATGTCGTTGATCATGTCTTCGAGGTCATGGATGCTCTTGACCCGGACGTGGCACAAACGGTCTTTTAAGTTTCG
GTCACCACATGTGACCAAGAAGTGTTCCACGTGGTCCTTCGCGTCGCGTCCACCGTTCTCAAACTGTACAGCGGCATTAGGGGCGTAGCCGTTAAACCGG
TTAAGGTAGTCACATACATGCTCCTTGTCCCCTCGCTTGGCCGAGTAGTATCGAGCCTTAGCGACTGGGAAGACCTCGAGCAGTAACTTAAAACACCAAT
TGAGTACACGGTTTCAATTTATTGCACGATATACATTATTAACCAATGCAATCGATCTATTCGACATTGTGATGTT