Description :
From Genome Similarity Track
Location :
Scaffold_601:2736- 5767
Sequence
3031 bases(100 bases per row)
ACATATCGCTTTAAACGACCCACGTAAAATACGGGGTGTGTTTTCATGTATGATGGGAGAGAGAGTCTATAATTTAGGTCTCCGACTTCCTCTGCCACAG
TAAAAGGACCGATAAATCGTGGCAATATTTTGGTAGTCCACCAGGTAATACTGAAACTGCATGTTTAGGTAGAGTATCAGTACTTAATAGTACTTTGTCT
CCTACTCTAAAGTGGTCATTTTTGCGACCGATTCGGTCTGCATATTGTTTTTGTTTGTCCTGTGTGCTTGCCATAGCGTCACGGACCTTACGTGTGATGT
TAATCGCTCATCCACAAAGCGTTGAGATTCTCTAATGCTCTTTGCATCCAGATCTCCAATGAAACTACCAAAAGCTTGGTCATGGGTCGTTGCTACTAAT
AATGATCTACCGTCATTTCTTTGGAGCACAGACAACGTGTGTCGTGACTCCGACTTGACACTCTCTTGTGTCATGACCACTGCAACACTGGCAGGGTCAC
TAGAGCGAGTTTCTACCGTAGCATTAGCGAACCTATTACGCTCTTCCGCATTTTCTCCGAGCGTAGTGAGGGGCTCTCCCCCACTAAGACTCGGGCTGCG
CACAAACGAGACTGGCGTCCGACGATGGAGCAGTCCGTTAATATAGAATGGTGCTTAACTCGTACTGGCGTGAACACTGTTGTTAATAACAAACTCCACG
AATGGCAAATGTTTGCTCCATCCCGTGGGAGTTGCTATTGTGCGCAATACATCCGCCCCAACACGATTGATCCTTTTGGTCTGACCATCGGTTTGGGGAT
GATCGGCGGTAGCCATGTAAATCTTCTTACCAAGCAGCTCAAACACATGGCGCCAAAACCATGACGTAAAACGTGGATCCCGGTCCAAAACTATGGACTC
GCGCATCCCGTGTAGTCGATACACGTGATCCAGGAACAAGAAAACTGCCTCCTTGCCTGAGATCTTGGTGCTTCAGGTGTTAAATGCACCATTTTGCTCA
GTCTGTCAACAAAGACGACGAGATCAGTCCTGCCTTTAAGGTCAGGCGGCATTATAAACATGAAGTCCAAACTGACCGACTTCCAACAATCAGTTGGTAT
TGGTAGTGGCTTCAGTGGTGCACTACTAGAAGGTGCAGGCTTTACGTGCTAACACGATTCGCATGATCGACTATAATTGGCTACCCATCTATATAGGTTC
GGCCACCAAAATCCATCTGACACTCGTAAGAATGTCTTCTCACGGCCCAGATGACCACTTAATAGTGCATCATGGAGCTCGTAGAGAATCTTCTGTTTGA
GATCTGTGTCATGGGGGCGATAGATTCTCAATGGACCACAAGGTGATAGTTGATGCCATAACAGGCCATCACTATAACTAAAGCGGTTAAGCTTCGCCTT
GAGGTGCGACAGAAGAGTAACTTTTCGTCCACCAAATTGACCTATAAGCAGACGACAATGTTCGTCCTACATGTAGCTCTCCTTTATGTCAGAGTCCAGA
GTTTTTTGCACATGGTCAAACCGTAGGGCTGCCAGTGGTGACGACTCAATTCGTGCTTTAGCACGAGACACGTCTTCAAGGTGTCGAACCTCGAAGTCTG
GTCTGCACGACTACGCGTCAGCCAAGACATATGACTTCCCCGGCTTGTATTCAGCTCGAAAATTAAATTCTGAGAAGAATGTGAGCCACATCTCCATCCT
AGGTGATAGGTGCGGAGAGTTTATCGCGGTCCGCAGTGATGCACGATCCGTGTAAACTACAAAAGGTTCGGTGCCCAATAGGTGCACTCGAAACTTAACA
AGACATACTTTATAGAAAGTAGCTCGTTGTCTTGCACGGAGTAATTCAGCTCTGCGGCCTTGAAAAGTCGGGACTGATACGAGATGACACGGTCAGTACC
GTTGTCATCCTTTTGCACAAGTGCACTGACGATAGCGAAATAACTCACATCGCAGACAACACAAAAGGGCTTATCCGTGTCTGGCAAAGCCAAGACCGGT
GCCTCTACAAGTGACTGCTTCACTAAAGTGAAAGCATCTACATGAGCCTCAGACCAAGTCAACTCTGCGTCCTTTTTCAGGAGGTCAGACATTATTTGGT
TTGCTCTGCATAATTCTTGCTATATTTGTGCAAGTAATTAGCAAGCCCAAGGAATTGACGCAGCTCTTTCACATATTGTGGGACTGGCCATTACTTAATA
GCTCTAACCTTCTCTGGGTCTGCTCTAACACCGTGTTTACCCACGATGCAGCCCAGTACAGGTATTTCGGGGACCCCTATGACGCACTTTTGCAAGTTGA
CGTGCAATTGGGCATTGCCCAGAGTCTGCAACACAATGTTCAAATGAGGTTTGTGCTATTCTATCGCACTCAATCTGTCCTCGGCCCTACTATGAACGAA
TAAATCGTTACAGTAATGAGACGCGTAGGTACGGTGTGGACGCATCACATGAGAGACCACCCGATTGAATGTCGCTGGTGCGTTTTTCAACCCTTGCGGC
GTCACTAGCCACTCCTACAGCATACCGATTGGGGTGATAACTGCCGTCTTGGCTACATCGGTCTCATTCATGAGTACCCGATAGTAGCCATCCTTCAATT
TCAACGCGGAAAAGATAGTTGAATTCCCCATTGAGTTCAATAAGACATTTTCCGCGAATCGGTTTTTGTGCAGGAGTGGTGGCCGTGTTCAACTTATTGT
TAGCATGAATTACGCGCCAACCACCTGTTGCCTTACGCACACAAAAGCTCGGGCTGCAGTAAGGCGATTTGCTTTCACGTACATGTCCCGCCTTGGCTCT
CTTGTCGAAGAACTGGTCGATGTAGTCAACCTGTTTCTTGGGCAATGGACACTGCCTGGTCACACAATACTTGGTTCTAGGTTCCAATTCAATCTCGTGC
CGGATACCCCTATCGGCCTGTAGGAGGTTCAGTACTTCTGTAGAAAAGACACCACGGTGGTTCCATAATACTTCGTAAAACGGACTGCTTTTCAAGGCGT
CCCAACCTTGAGGAGCGAATCGTTTTGTTTT