Description :
From Genome Similarity Track
Location :
Scaffold_1184:2736- 3811
Sequence
1075 bases(100 bases per row)
CCACGCATGAAATAATAATTGATGAAATCCAAGTGGGCGAACCAGGTGTCCCAAGGACTGATGATCAAGAGAAGTTGCGATAAGTGATTTGGAGGAGTCG
CCATTTGCTGATTGGAAAAGGTAATGAATGCTCTACCACCTGCGGCGAGTGGGGCAGTTTTTGATATATATGTGGGTGGGGCCAACCCGGTCACGCAGAG
GGTCAGGCCTGTGGCTCCCAAATTTCGAGAGAAACTCGCCGATCTGATTAAAGAATTACTGTCGACAAGATCATTCGACCATCTACAGCACCATGGGCAT
CTCCTATAGTGGTGACCATCAAGAAAACAGAGAAGACATAAGGTCGTACTTTGATTGCAGGATGTTGAATCCCGCTGACTATGTTGATGGTATACCCTAT
GCCTCTAATCAGTGAACTATTGCAGGACATGGATAAAGCCATGTGGTACCGGTCTCTGGACATGGCGAGTAGTTTTCGGGTGGTGAAAATGATTGAAAGG
GCAAGGGCGACTTCCACTTTTATCACACCATCATTTTGTTTTTGAGTGGTTACAGATGCCTTTCGGGTTGAAAAACGCTCCACAGATTTACCAACGATTG
ATTGATAACGCTCTCTATGGATATTTGAAAATCGGCGCAAGATCCGAATCGATCACGGCCAAATCGATGTCATCAGCGATGGTGAACCCGATACTTATTC
GAAACCATCAGTGTTGTGTCGAAGATCCTATGTCGACGACATGTTAATACGAGCTACGTCGTAAAAATGCCTGAGTGAGAAAGTGAAGAGATTATTGAAG
GTGTACGATAAGTAGAACTTGTCGATCAGTTTGTCCAAAAGTTTCTGTGGACGTCGGAAGGTGGAATGCCAAGGACATCAAATCTCGCTTGCAGATTTGG
AAGCTAAGGCGAAAGATTTGGGATCTTTGGTGAGCAACCCGTTTCCTCGGGCGCTGCTATCGATACAGTCATTTTTGGAAGTCTCAACTATTACAGTCGA
TTTATTGAAGATTTTGCGATTTACGCCTCAGTGTTGTACGAGCTGCGTGAAGCAGATTTCTATGAGATCAGCCGC