Description :
From Genome Similarity Track
Location :
scaffold_350:27358- 29298
Transcript NameFunction/comments
g7536.t1 heat shock 70 kDa protein, mitochondrial precursor

Sequence
1940 bases(100 bases per row)
CGTCGTGCACGTTCTCGTCGTTGTTCTCTTCGCTGGAAGCACCCTCGCCCTGCTGAGACTTGTAGACGGCCTCACCGATCTTCATGGACATCTTCTGCAC
CTCCTCGAGAGCAGCCTTAATCTCCTCCGTGTTGTCGCCCTCCGACTTGGTCCGCAGGTCGGCAAGAGCAGCCTTCACCTTCTCAAGGGTCTCAGCGTCG
ATCTTGTCCTCGTGCTCCTTCAGGGTCTTCTCCGTCGTGTACAGCGTCGAGTCGGCCTCGTTCTTGGCCTCGATCAGCTCCTTACGCTCCTGGTCAGCAG
CGGCGTTGGCCTCAGCGTCAGCAACCATCTTCTCGATCTCAGCGTCCGACAGACCGCCGCTCGACTGGATCACAATGTTCTGCTCCTTGCCCGTAGCCTT
GTCGCGGGCACCGACGTTCACGATTCCGTTGGCGTCAATGTCGAAGCTCACCTCAATCTGGGGCACGCCACGCGGGGCAGGCGGGATGCCCACCAGGTCG
AAGTTGCCGAGCAGTTTGTTGTCGGCAGCCATCTCACGCTCGCCCTGCAGCACCTTGATGCCCACCTGCGTCTGCGAGTCAGCAGCCGTCGAGAACACCT
GCGACTTCTTCGTCGGGATCGTGGTGTTACGCGGGATCAGCTTGGTGAACACACCGCCCAGAGTCTCAATACCCAGGGACAGGGGCGTCACATCCAGCAG
CAGGATGTCCTTCACGTCACCACGCAGCACGCCGCCCTGGATGGCAGCACCCATGGCAACAACCTCATCGGGGTTAACACCCTTCGAGGGCTTCTTGCCG
AAGAACTCCTCCACGGTCGTCTGCACCTTAGGCATACGCGACATGCCACCGACCAGGATAACCTCGTTAATGTCGCTCTTGTCCAGACCAGCGTCCTTGA
CACACTTCTTGCACGGGCCCATGGTGCGCTCAATGAGCTTGCCCACCAGCTGCTCAAAGGTAGCACGGGTAATCTTCATGTTCAAGTGCTTGGGGCCGGT
GGCGTCGGCCGTGATGAAAGGCAGGCTGATGTCCGTCTGAGCCAGGCCATCAAGCTCACGCTTGGCCTTCTCAGCGGCCTCACGGAGGCGCTGCATGGCC
AGGTTGTCGCCCGACAGGTCGATGCTAGTCTCCTTCTTGAACTCGCCCACGAGGTAACGCAAGAGCTCCTCATCGAAGTCCTCACCGCCGAGAAGCGTGT
CACCGTTGGTGGACTTAACCTCGAACACACCGCCGGAGATCTCCAGGATAGACACATCGAAGGTACCGCCACCCAGGTCGAAGACAGCAATGACCTTGCC
GTCAGCCTTGTCCATGCCGTAGGCAAGGGCAGCGGCCGTGGGCTCGTTAATAATACGAAGCACGTCCAGACCGGCAATCTTACCGGCGTCCTTAGTGGCC
TGACGCTGCGAGTCGTTGAAGTAAGCAGGGACCGTAACAACAGCCTGGGTAATAGGCTTGCCGAGGAATCCGTCCGCCGTCTCCTTCATCTTAGTGAGCA
CCATGGAGCCGATCTGCGACGGCGAGTACTTCTGGCCCTTGGCCTCCACCCAGGCGTCCTTGCCATTGTTTCCCTTAACGATCTTGTACGAGACGACCTT
GGACACCTCCTGGGTCTCCTTGTCCTCGAACTTGCGGCCAATAAGACGCTTGACAGCGTAGAACGTGTTCTCCGGGTTGGTCACGGCCTGACGCTTAGCA
GGCATGCCCACAAGGCGCTCGTCATTGTCCAGGATGGCCACAACCGAGGGCGTCGTGCGCGCACCCTCCGAGTTCTCGATCACACGGGCAGTCTTGCCCT
CCATAACGGCCACGCACGAGTTGGTCGTGCCCAGATCGATACCGATGACCTCGGAGCCTGCAGCGGCCGAGAACATGCGCTTGGCGGCTGCCGAGGCGGG
GGCGGGGGAGCGAGCGGCAAGACGCAGCATGTTAGAGCGG