Description :
From Genome Similarity Track
Location :
contig_179:27357- 28402
Transcript NameFunction/comments
g11411.t1hypothetical protein PHYSODRAFT_344027

Sequence
1045 bases(100 bases per row)
GTCACTCCTCGCTAAACTCGGTCCACTCCATATCGAGGACTGCGTAGAGAGCAGCTTCCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTT
GAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGAGAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAG
CCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCGTCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGA
CGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGGTGTTGCGCTTCCAGTCGGCGAGGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTG
GTAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAGAGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGC
AGCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCATCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTA
GCTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCCAGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTC
CGAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGCCTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTG
CCAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTAATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCC
CCAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGACCTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAG
CGGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCAT