Description :
From Genome Similarity Track
Location :
Scaffold_178:27356- 33789
Transcript NameFunction/comments
Phyke_g5973hypothetical protein PHYSODRAFT_509192
Phyke_g5974protein phosphatase 2C, putative
Phyke_g5975hypothetical protein PHYSODRAFT_508758

Sequence
6433 bases(100 bases per row)
gctgctggtgctgggGGTGGCATTCCACGCCCTGTACGTGCTCAGTATCTTCGACATCTACTTCACGTCTCCAGTCGTAACACACATAGAGAGCGTCGCG
TATACGGACTCTCCTCCAGCCAAGCGTGTCGTTATTTTCGTAGCTGATGGCTGTCGAGCCGATAAATTCTTCGAGGCCAACGCTTCCTCACTCAATTCAG
ATACAGAGCTCCGCGTATCATTTTTACGTGATATGATTCGTACAAGAGGCAGTTGGGGAGTCTCCCACACTCGCGTACCCACTGAGAGTCGTCCTGGCCA
CGTCGCGCTGTTCGCTGGGATGTATGAGGACGTGAGTGCAGTCACAAAAGGCTGGGCAGATAACCCCGTGGATTTCGACTCTGTATTTAATCAGAGCAGC
AGTTCTTTTCTATTTGGCAGCCCAGACATCGTCCCCATGTTTGCGCGTCATGTGCCTCAAGCCAGAGAAGAGCACTATTcacatgaagaagaagactttG
CCAAGGGAGATGCCTCCGAATTAGACATCTGGGCATTTCGCCATTTCCAGAAATTATTGGAGAAGTCAAAAAGTGACCAGAAATTGAGCCACCAATTACA
TGATGACGGAGTTGTGGTGTTTTGTCATTATTTGGGCATTGATTCCAATGGACATGCACATCGACCGAATTCTAAAGACTATTTGAACAATATTGCACTT
GTGGATGAATTGGTGGAGAAAACTTATCGGATGGTAGAGGAGTTTTACGAATATGATGGGCGGACCGCGTATGTGTTCACGGCGGACCACGGGATGGGGC
TCAAGGGTGCacatggtgatggcgacCCAGCCAATACGCGTACCCCGTTGGTTGTCTGGGGTGCTGGAGTACAGGAACCTACAGTCGTTGAGACGAAGAA
TTCGGGCTTTGAAATCGATTTGCCAACGCAATCAAGAGCGCAGGTTCGAGCACAGTTGCAGGCacaggaagagcaggagcatGCAGCAAAGAGTGAGTGG
GGAGCTCTTGACAAACTGGTGCGGAAGGACGTGATGCAGGCTGACGTGGCTCCGCTCATCAGTGCGTTGTTGGGATTACCATATCCTAGGAACTCGGTCG
GGGTGCTCCCGTTCTCGTATCTTGCGAAGGGTGCCTACCGTGCCAACGCCGTTCGCTCCAACGCGCAGCAGTTGTACCTGCACGCGTTGCGGAAGGAGCA
AGAAAAACGTTCGCGCACATTGTTGCGCTTTGTTCCTTACGGTCCGTTTCGCGACCGTATACCTGAGCTCTCAAAACAGCTTGTTGAAGCCTATGATGCG
AGCATTGCGAATGAGAGGCTTGAGGAGAACTCAGACGCGTACGAACGCGTAGAAGTGCTGAGCCAGGAACTGATTGAAATTTGTCTGGACACCCTCGAGT
ACTTTCAGCGGTACGACTGGTTTTTCTTGCTCAGTATCGTCGTGCTGGGCTATGTCGGATGGATGATCGTAGTGGGTGTAGCCTACCTGCATCCACAGGA
TTTCCGTGTGAGCTGGTTGCTTGGCGCACGCGGTAAGCAGGTGGACATCAAACTGTGCATCATGGTATTTGCAGTTTTCATGTATCTGGCCCTCGAGGGA
TCGCCGATTACATACTACCTTTACGTGTTGTTCCCGCTGCTTTTTGGAGTGTTTACGTGGAATCATGCTGACCTGATCCATGAAACCTGGACATCCAGCG
CGAGTGGCAGCCACGCTAAATCTagctggaagtggtgggCAGAACGCGCATTAATTATGCTGTGCCTAGAGCTTGTGGTGATCGGATATGAGCGTCGTGA
AATTTTTGGCGTGCTTTTCTCTCTACTAGCGCTGTGGCCATTTGTCGGCACATCTACGAGAGAAGGTGATGGCCAAGTGCGTGGAGGAATTCGGAGCTTC
CCCTCACCGAGTCAATGTTGGTCGGTTAGCTGCCTGCTCATCTCAGTGTTCCCATACTTGCCCAGCGAGTATGGTGAACATACTGCGCTTGTGAACATTG
GAggtgtgctggtgttgctcTTTGCAGGCATGGTGTTGACCATGGCAGGTCTGTCCCAGCAGAAGATCTGGACAAATCCCTCATTTATCCTGAGTATCAC
ACCGTTGGCGCTGTCATTAGTGACGCTACACTACACAATGCAATACCTGGATGGAGAACGAAGCAAACCGCCGTTCCTGCTCACAGCAGCTAATTGGGTG
CTGGCTAGTTTGCCcatcgtggtgctgcttgtgaagctgcaaaaaGGAATCGCCGGGCAATCCCGTATCTTAGAAACCGGTGCGGGCCGTTACGacccac
agctgcagcaagctgAGGTGGGACGCTACGTGACACGGATCATCGACGTAATCCTGGCGTTTGCGCCTTCATTCACACTTTTGAGCATCGCCTACGAGGT
GCTGTTCTATGTGGTGCTTTGCGGTGTTCTCGTAAGctggctgttgctggaggccGAGACTTCATTTacgtcttcaacatcgacgTGGCGTGAGGTCCAG
AGAGCGTttgtgttcttgctgctAGTAAACATTGCCTTCTTCGGAACGGGCAATGTGGCCAGcatgagcagcttcgagaTTTCATCCACATACCGCTTCG
TAACGGTGTTTGCACCCTTCACCATGGGCGCGCTGCTGGTGGGCAAGATCCTGATTCCGTTCATGGTAGTGGCTTGCACATTCCACCTCATCCTTCTGTT
ACCATCAGCCTCCTCTGCTGGTTCGCAGAAACCGCGCCTACCTGCGTCTCGCTATTTTCTGCTGGTTGTGGCCATGTCGGACGTCCTGGCGCTTCATTTC
CTCTTCCTAGTCAAGAACGAAGGCAGCTGGAAGGAGATTGGCAACTCGATCTCCATGTTCGGTATTGTCAACGCGCAGATCGTTTTCATCCCGCTACTGT
TTCTGCTAGCGCGTGCTTTCGTGCGCGACTTGACACCTGCCACTGGCTTATCTGGTCAGAGTCTTcaggacaagaagcgccaGTAATCCACCAACTATAG
AGCACTATAGAGCATAGAGCCACGACGTCCAGGAAAGACAAGTTAAAGTTCTTTTCAATGCATTAATTGCGCGTGGAATTTATTAAAGCCGTACAGGCGA
GTGTATGTCTGTGTAGGCAAAAAGGTTTCGAGGTGCTGATCCTGTGCCCTCAAGCCGAGGAGCTTATAACATCGTCCTTGTTGTTTATACGGTGACCTTA
TCAGGGGATTTGAGGCCGGCCGTATCGACGTAAGCTACAATGATCGTGGTGTCATCGATGACTTGTTCCTCCTTCATCCAGCGGCGGTTGGCCTCCATGA
TCAACAGGTCTACAGCCACTTTCGGGTCTTGTTGCCCCATGGCGATCTCCATACATTCTTCGTTCGACATGAATTCCCACAGACCGTCCGTTGCCACAAT
GAGACACCGATCGTTTGCATCCAGCCAGTGAGACGTGAACTCGGGCTCAGATAGCACGCCTGCTGTGTGTGCCACTGCATCACCTAGAGACCGAGACATG
GCTAGTCCTGGAACGTCCATGTGGCCCAGCCACACACGTGGCGGGCCATCGATCCCGTCGTCGTACTCCACCGCAAAGACCCGTCCACCACTAGCGACAA
TGCGAGCTTTCTCATCCGGCCGATCGGGTTTGTGATCAATCGACAGCTCCTTGCAATCCACAGCATCGGGACCCGAAGGACTGAGCTGTTTGACAAAGCC
GCGAGTGATGCGCGAGTCGCCGACATTGCCAACCACGACGAGGTTGTCTCGAATGACACTCACCACTGCAGTCGTACCACTGAACTCTGTGTCGATACTA
GGATCACGAAGCACAGTCTGCTCCACAGACTGTAGCGTGTCTGTGATGGCTGTACGCAAGGTCTCAATATCGCTCTGAATGTCCCCTGTGCGTGCAAATT
TGGCATGTGCGAAGAGTTCCGTGGCAAACTGATCCCGGATCGCTCCCGAGACTCCGTCCCCAGCTTCACCGTGACCGTCAAacacacacagcagcagcga
ctgcgtGTTCTGGTCATACTTGATCACCATAGAATCCTGGTTCTTCTTACGCGGATTGTATGGGGCGTACCCTTTCTTGGACAGTCCGGCAAAAGCCATA
ATGGCAGAGTTCTCGTTCGCCAATACATTGGCACTGCTAtccacgtcgtcgatggttgctgcagccatccCATCCACAAGTTTGTTGTCGCTCACCACCG
ATAGTCGGCGACGTTGCAGACCGAGGGAGTGATCGCCGCCAGCTTGAGCTGCCGGGAGTTTCCCAGGCGTCTTGATGGAGATACCCTTGGGGGATGCCAC
ATTGGTGGCCGTAGCCTCCGTTAGACGGATTTTGGCTGTCGAGCCCATCTTCTGGATCGAACGAGTCGCCATTGCTTCTGAGGGGATGAAGTCTTTAGCG
GAGACGAGGGGTCAGGCTGGTAAAGCGcaggagacgctgcaaatACCAGAGTGATCCAACCGACTGGTAGGGAGCTACGATAAGGTCTAAATCTgacctg
ctgcagcgacgactGAATAATAATAGCGAGAGAGGTGAGGGCGATGAAGCAGCGTCAAGTGGCAAAGCAAAAGTATGGGAAGGGGCAGTGATCAGATACC
TATAGTCACGAATCATTCAGACGTGTTATGCCGTTGCacgagatggaggagatcgagacAAAGAGCTAATTAAAGAGAAAGCGAGTGAAGGGAGGGGAAG
TCTTGACTATGCATGGAGCAGATAAGCTTAGCTTTAGCAGCACTGCTCGGCGTAATGCACATACTCCTGATCAAGTATATGGAGAAATTCAAATTTGACA
ACCAAGATCGGCGAAGGATCCACGATAGATACCACCAGATTGAAGTGACTGTAGCCATCTCACAAAcgaatggctacactttACTTCTAGTTAGGAGGTG
TTGTGTGTGGAGCGGGATTTGCTTAGTCgctgtcttcatcactctcatcttctgaagatgacgagagGCTGAGCGAGATGGTGTTCGGTGcctcctcgtc
gctgtcacTAGAGTCACTTGAACTCTCACTCTCGGCAGTGCCCTCCTCGGCCTTCTCGTTCTCTTCcagtttgcgcttcttgcgaAGACtctccacatcg
tccaccacctcgtcgTCATACAATGGTGCTCGCTTCTCAGGCagcttgaacttcttgcgAAGGATCTCCATAGCGTCTGGTGGTAACGGGTCTCCCGTCT
TCCAAGACTCGGGCAGCGTGATCCCGTGTTCCTACAAGTTGAAAGATTTACCGTTAGTCGTCAACGAACGGATCTTCGTACTGAGCGAGCATGTACGTAC
CGCAAAGAAGCTTCGACCCATGTAGTGCAGTAGTGCGTCGAGCGGCAGGTCCACTGGGTCGCCTGGTTTCCATCCTGGCGGCATCTGTTTACGGATCTGG
GCGTCGCTCGCACCCAAACCGATCGGAATGTCGAGCTTCTCAAGAGCCTCCcctccatctccttcctGCTTCAcccttgctgctgtagacGTGTATTTCT
CCGGGCCTTGAGTAACAATCTCGGCCACAATACCTCGACTGAGGACACCTGCACGCATCATGTGCTCctgaggtgctggtggcatGAAGCCAAACATCGG
AAACTACGTAAAGGCATTGCTAGTCGTTAGCGACAACGAAAGCACCAGAGTATTGCACAATGAACGTACACCAGGTTGCCATTCTTTAGGAGCTGACGTT
GTACCAGCAATCCGGTGCGCATACGCCACAATGTCAAGAGGGTTTAAGACCACTGCACCAAATCAGAATAAAAACAAGTGTCAGTCGGCATTTCTCATTT
TGCAATAATATATATATACTCCTATACCTTTGGACTTTTGCTTGGCATTCTGCAGCACTACGCGGTGTTTCCTCAACACATTAGCAATATCCTACACAGT
AGAGAGAAAAAAGCTCTACAACGTCAGTCAAAGAATCATCGCAGCTCTTTACTGCTCCCTCCTCTCTTACCTCCTGAGACCGACGCAACTGAGCTGCATA
CTGCACTActttctgcttcttgttctcgACTTCTTTCTCAATCCGCAGCAATTCTTTCTGCGCCACTTGGTGCCGAGCCACTTACATTCCCACACAAAAG
TACAAAATAACGTTAAAAACAGCATTTCCCCATTAAAAACGGCCTCAACGTAcgcttcttcactgcagtcAGCAGGTCTctgtccttctccagcactttg
TTAAATGTCTCGTTCACAGTACGCAGTCTCATAGCAGTGATCGTGGACGGAGGGCTACAGACATTTAACGTGTTTTTTATAAGGTTAATAGTGGGAATTA
GGACGTGGAAATGTATTTAAACAATAACAGAGCAGCAAAGACGCACAGGGAAGCTGTGTTGAgcgactccagcagcttggtgacCAGGAAGCGGTGCTCG
TgcagcgccacctccacctcctcgCGGATGCTC