Description :
From Genome Similarity Track
Location :
Scaffold_155:27356- 28523
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_155-fgenesh-gene-0.6Dicarboxylate/amino acid:cation

Sequence
1167 bases(100 bases per row)
CCCGGCGCGCCTCCCTCCTTTCCAGCTCCCAGCTTCCAGCAGGTCTCTCTCTCTCTTTTGATAGCCGCCATGCCGTGCTTCTTCTCGGAGTGCGCGCCCA
TGGGGGAGCTCCAGCGCTTCGGCACAGCGCTCGCGGGGCTCTACGCGTACCACTTTCTCTGGGACCAGCTCGCGATCCGGCCCGTGGCGCGCTGGATGGT
GCGCACGCACTTTATCACGAAGGACAAGTTCGACAAGATGCGCGAGTCGCTCTGGAAGAACGCGGCGGTCGGCACGTTCTTTTTGCTCGGGCTCTACATT
GGCCACGACAAGGACTGGTTCATGAATCCAAAGGGCTACTTTATCGAGTTTCCATACGAGGCGCCCGAGATCTTGAAGTGGTACTACATGATCTACCTGG
CATTCTGGTTCCAGAGCATTGACTTTATGCTGAGTCTCACGAGCAAGCAGTACACGGTCAAGCGCAAGGACAACACCGAGATGCTCGTACACCACTTCGC
CACCATCTCGCTCATGCTCTTCTCGTACTACTTTGACCTCACGCGCATCGGCATGTGCGTGCTCATGATCCACGACATCAACGACTTGTTGCTCGAGTCC
GGTGCGTTTATTTTTTCCTTTTGCATTCGATTTTTCTGTGGGAATACGAATGTGCTGATGACAATGCTTACCTTGCTTTGCGTGTGTGCCCCCTCTATGC
AGCCAAGGTGTTTGTGTACTCGGAGAACGAATTGATCGCGAATATCCTGTTTGGCACGTTTGCGCTCGTGTGGTTCCTCGTGCGGTGGGGATTCTTTTCG
TACAACATCCTCTACAGCGTGTACACGAACGGCTGGAACGAGATCGTACAGCCATCGTACGATAAGGGCGAGTATTTGGGCATGAAGCCACAGATCTGGT
ACGCGCTCTGGTGGATCTTTTTCGGCTTCCTGTCGCTGCTACTCGTGCTGCACATCTACTGGGGCATCCTTATCGTCAAGATGGTGATCAAGGCGCTGGG
CGACGGCAACGTGGAGAAGGATATCCGCAGTGACTCGGAAGCCGAAGAGGACGAAATCGCGAACGACAAGATCGTCGGCGAACAGGATGACGGCAGCTCG
TCAGACTCGGCGCCCGTTGCCAACGGCAAGCCCAAGCGTCGTCGCGCCCCCAAGGCCGAGTAAGCAG