Description :
From Genome Similarity Track
Location :
contig_1:273555- 275101
Transcript NameFunction/comments
g78.t1hypothetical protein PHMEG_0003934
g79.t1hypothetical protein

Sequence
1546 bases(100 bases per row)
AGACCTGGTGCAAGACTCGAACGCGGACGCCCAGAAGCCCAACATGCGCCTCAGTATTTGCGTTGTATCGGAGACAAGGGACGGGAGGTGAGCATTATTG
GTTGCCAATGGGTAACCGTTTGAGGCGGCTGCTAACAAACTTGGTGCTGCTGTGCAAGAGTGCTCATGCGGAAGGTTGGCTACGTGAACAGCAGTCATCG
TCGATGCGCTGACGACAGCAAGACTCTTGCCAGTGTACGATTTCATCCAGGTGACCTGGTAGATATTGCGATGGTAGACTAGGAGCAGCGCCATAAGCCC
TCGGACAATACATCAGATGTGTCTGAAAGATAGCGCCGTATCCAATACTCCTCTTAGCTGATACTGCTTTCTGCAGGTTTTCTGATTGCCAGCAAAGTCT
CACACACACAAGGGAAGATGGTGCTGGTGAGTACGGACACTTCTTGGTCAAGGTGGCGGAGTTGTACGCGGAGGGGCAGAGCTCCAAGGGCTCGGTGGCC
GTATCCTGCAAGAGTGGTGCGTCCTGCAACTGCATTAGTGTCTCCCCATTGTCTGACCTTGTCCACACTTTCATGACGCAGTGCCAGTGGCTAAAGTGAA
CACCAAAGCGCAGCAGCAGATCCGCAAGCTCTCGGTGGAGGACGGAGAGCACGTGCTACTCTTCCGCGTCTGCAAGTATGGAAACAACAAGCACAAGAAG
AAGTACAGCACGGTGGTACGGATGCTTGGCAGTTTGTTGAGGGGGTCCATTGGACTAACTGTAACATCTTTCTTGTGCTCAGGTGACGTCTGTGAGCCAC
GCGTCGTTCCACGCGTCTCTGAGCCAGATCGTCAAGACTAAGGTGGACGTGACCGTCAAGGATGTGGCTGGCAAAGGCCCAAGCGGGTGGCCAAGGTCAA
GAAGACCACGGAATAGATAGATGGACGTCCTTGAGATCGAGAAGGAGAGCCAAATGAAGAGTTCTGATGATTACAAAGCTACAAGGGTGTACACAGGTTC
AGTTGGTATCGACCCGAGATGTAGATATCTCTGGTCACTGCGTAGACGCCGGAGATGCAGCGATGATTTGGTCTTCGTCGGTCTGGATGTACGTGTTGAA
GGCTGGCAGTTCGTCGATGAGGGTCATGTCCCCAACACGTCGCCTAAATAGTGGTTGCGCCGGGATGTCCGTCGCCGACCCTCTTGCAAGCCGGTGCTGG
ACAGCAAGCGCCCGACCATAGGCATGTAGTCGAGCACGAATTGCGGCTCTGAATTCCCACAGCTGGATCGGAAACAAAGAGCGTGAGATGGTAAAACTGC
AGTCCAGTGAGTACTGCCTAAAACGCACCCTTTGTAAGCAGGCGGCAGTTCAAACTTGGACTTTAGCTCCGCCAGCGCTGTCTGGTGGGCGCGTCGACGG
GAAGCAGCCAGAGCGCTATCGAACGTCCGCTGCACACAAGCCGAGGCAGAAGGTCCTTGCCCTCGCATCAGCAACGCACCGAGAGGGTTCGTCGATGAGA
CTAGCATGTGGAGACTGGAACGTCTCAACTCTAAGGCTGCAAGCCG