Description :
From Genome Similarity Track
Location :
contig_62:273476- 276259
Transcript NameFunction/comments
g11426.t1hypothetical protein

Sequence
2783 bases(100 bases per row)
GTGTATTTCAACTACGCGCCGGGCAACGCGACGTTCGACAAGTGCTCGAACGTGGTGGTGACGTCCAAGTACTCGCTCGTGACCTTCCTGCCCAAGTTTC
TGAAGGAGAGCTTCAGTAAAGTGGCCAACTTCTTCTTCCTCATGGTGTGCGTGCTGCAGAGCATCCCGAGCATCAGCAACACGTACGGCTACCCGACGAA
CGCGCCCGTGCTCTTCTTTGTGATCTCTATCGACGCCGTGTTCGCCGTCATGGAGGACATGCGCCGCCACAAGTCGGACAACGAGGCCAACTCGGCCACG
TGCCACGTGGTTCAGGACGGACACGTCGTGGACAGGAAGTGGTCGGACATTAAGGTGGGAGACTTTTTGCAGATCAAAAACCGAGAGGTCATCCCCGCCG
ACGTGCTCGTGTTGGCTGTGGCGGAGCCTGTGGGCGAACCGCCCAGCGGCATTTGCTACGTCGAGACCAAGAGTCTGGACGGAGAGACGAACCTCAAGCT
GCGCCAGGCGGTGGCGGCGACCATGAGCTCGCTGGCGAACGCGGCCGAGCTGTCCTCGCTGCGCGGCGTCGTCAAGTGCGAGCAGCCCAACCCGCACATT
AACAAGTTTGCAGGCAAAGTGGAGGTTACAGTGGGGGACGGCTGCGGCGTTGAGGTGATGCCGCTGTCAGTTAAGAACGTGCTGCTACGCGGTTGCAACC
TGCGCAACACGGACTGGGTGTTTGCACTGGTGCTCAACACAGGCATCGACACGAAGATCATGCAGAGTTCCAGCGCCGCCCCGTCCAAGTGGAGCGACCT
CATGCTCAACATCAACCGGATGATTGTCATTCTGTGCATCGGGCTCTTCGTGGCCTGTGCCGTGGCTGCTACGTGCTACATCACGTGGCAGTACGACATC
GTGCGGAACACGTGGTACATCCAGCTGTCCGAAACGGAGAGGAACCGCACGCGCTTCGTAGCGTTCATCCAGATGATGTTCTACTACTTCTTGCTGCTGT
ACCAGGTCATTCCGATCTCGTTGTACGTGTCCATGACGAGTGTCAAGTTCCTGCAGTCTCGTTTCATGTCGTGGGATCTGGAGATGTACCACGCCGAGAC
GGACACCCCCGCTATCGTACGGACGATGGAGCTGAACGAAGAGCTGGGTCAGATCTCGTACGTCTTCAGTGACAAGACGGGAACGCTGACGTGCAACATC
ATGGAGTTCCGCAAGTGCTCCATCAATGGAATTTCGTACGGCTCCGGTATCACGGAAATCGGACGCGCTGCGCTGGTTCGCGCGGGAAAGCCCATTCCAC
CGGAGCCCAAGCTGGACCCGAGCATCAAGACGATCCCGTTTGTAAACTTCGTCGACAAGGCACTCTTTGACGGAATGAAAGGCAGCGCAGGCGAGGAGCA
AAAGGAGAAGATCCTGCAATTCTTCGAGCACCTCGCTGTGTGCCATACAGTGATCCCCGAGAAACTCGAGTCTGGTGAAGTCCGGCTATCAGCGTCGTCT
CCTGACGAGCAAGCCCTGGTGGCTGGTGCTGCCTTCGCAGGGTTTAAGTTTGAAAGCCGTAGCGTGGGGACAGCGAACGTGGAGGTCATGGGCCAGCGCG
TGACCTACGAAGTGCTGGACGTGCTCGAATTTAACAGTACGAGAAAGCGTATGTCTGTGGTGGTGCGCAAGCCGGACGGAGAGCTGCTGCTTTACACGAA
GGGAGCCGACATGATGATTTATCAGCGCCTGAAGGATAACCCAGCGATGCAGAAGATCAAGAACATCACACGCGACCACATGGAGAAGTACGCTGACGAT
GGCTTGCGTACTCTTGCTCTCGCGATGAAGAAACTTGACGAACGCTGGTTCCAACAGTGGAAGATGCGCTTCGATGATGCGCAAGGCAACGTGGCGGAGC
TCGACCGACGCAAAGATGGCAAACCCAATGCAATCGACGACCTCATGGAAGAAATGGAGGGGGGCTTGGAGCTGATTGGCGCAACGGCGATCGAAGACAA
GCTGCAAGATGGTGTGCCGCAGTGTCTCGCAAACCTGACGCGTGCTGGAATCAAGGTCTGGATGCTTACGGGCGACAAGGAGGAGACTGCGATTAACATC
TCGTATGCTTGCTCGCTGCTAGACAACTCGATCCAGCAAGTCATCGTTAACGCGACCACATGCCCGGATGAGGCGACGATCCGAGCCAAATTGAATGCTG
CGGCCCGGGAGTTCATGGAAAACGCGAAGGGTATGGCAGGTGGGGCCGAGAAGGAAATCTCGCTGATCATCGACGGCGAGGCTCTTGAAATGGCCCTCAA
GCCTGGAACTGCGCCGCACCTCCTGTCGTTTGCCAAACTGTGTCGCGCGGTGATTTGCAACCGTGTATCTCCGGCCCAGAAGGCGGAGATGGTGAAGCTG
GTCCGAGATAACATCACCACGGTCCGTACGCTTGCTATCGGCGATGGTGCTAATGACGTTGCCATGATCCAAGCCGCGCATGTCGGCGTGGGTATCTCTG
GACAGGAAGGATGCAAGCTGTGAACTCGAGTGACTACGCCATTGCGCAGTTCCGCTTCCTTGAGCGGCTGCTTTTGGTTCACGGACGGTGGAACTACATT
CGTATCTCCAAGCTGGTGCTGTACATGTTCTACAAGAACATCACGCTCGTGCTGGCGCAGTACTGGTACGGTTACCTCTCGGGTGCTTCTGGCTCCAAGA
TGTACTGGGAAATCGGTGTCCAGCTTTACAACGTGGCTTTCACGGGTCTTCCGATCGTGGTCGTGGGCGTGATGGACAAGGAC