Description :
From Genome Similarity Track
Location :
Scaffold_33:273452- 275212
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010922Similar to HERC6: Probable E3 ubiquitin-protein ligase HERC6 (Homo sapiens)

Sequence
1760 bases(100 bases per row)
CAACGAAACACGAGCAAAAAATCCCGTACCTGAAGGCCCATGCGATCGCCGACGACGCGAGTTGGCAGCTCCCCATTCTCGTCCGCAAATGTACTGAGAA
GCTTCGTCTGGCTGTATAATTCGCAAATCTCGCACTCGCGGAACATGCGACAGAGCCGACAGGATGCGCCTAATGTGGCCGCATCGCCGCGACCGAATTT
CCGGTACGATCGAGCAAATGCGTCAAACTGGCGCAGGATCGTCGCGTTGTCCGCGTCTGCTTGGATTGCACGCAGATAATAATCCTCCAACACGCTACAA
AAGCAAACCCATTCTTAAGCGAAGTCACAATATCCAACGTGGAATGCATTGGAGATACCTTTCCTGGCTGGTGGGCGGCACGACGACCATCGTGACTTCG
TTCGCGCAGTGCACCGAGCCAACGCGGCCCACGGTCTTGAACGCCGAGTACACGCCAAACACTTCGACCTCGGCAATGTGCAGAAAGTTGCGGTTCTGCA
GCTGGATGCGCACGTACTGGCCGACAGTGTTGGCCGTGGGCAGCACCCACTCGGTCATCCGCTTGTTGTCTTTGAAGAGCTCGAACGCGCTGGACTGCAC
TTTTGCAGCGCGCAGACTGAGGAAAAAGACGCACAGCACGTCAGAAGCTGGCCAAGTCCTCAGAATTTACCATTTGTAGGCAACAAGGTGTACCCTTCTT
TGCCTTCGAGATCTTTGAATTCGAACTCGCTCACGAGGATCCAAAATGGGAACAAGCGGCCCGTGTACTCGTCTCTCGCCTTGGACGGATTCAACGGCAC
ATCCGTACGATTCCAGACCTGCCAGCGAGCATGGAGCACCATCAGCACAAGTCAGTTTGAGCCACTTTAGTAGATCGTTCACGAGACGAAGACGCAGAAG
ACGCACCCGGATGCGCTCAATGACCGCAGGCTGCCCGAGGTTCACTTCCCACCACGGTTTATCTTCCAGCTATGCATTCCAGGAAATGTATACGCAAGCA
CATACGTGAAGCATTAGCTCGTCTTGTGCCTCGTAACTCAAAGAGCTCTAGTGGACGTACATGGGTATGGATGCACGTGCCCAAAGTGCCGTCGACGGCA
CCATTCACAGCCAGTTGCGGGCCCTGTTCGTTATAAACACTGATTTGACGACACGGTTTGCCAAACAACAGGTTGTATGGCTCCACATGAAGGCACTTCA
GGAGGCGTGGCCTTGGGAGGAACAACTGCTTCTCAATGCATGCGATTCATGGCGTTAGTTCATTACCCAAGCTCCCAGCACCTCAAGAAAAGCAACGCAG
AGTCGTCTCACCGTGATTGCGTGGCCCGTGCATCCTTTATTGTTCCTCCCCCAGGTGTACAGCTCGCCATACGCCGACACGGCACCCGTGTGGCTCACTC
CACACGACACTTGACGAATGCCGATGTCGTTGAGCTCCGGGACGAGTTCCCACGTCGATATTTGCCGTCCGAGAGGGATCGAGCCGCCACACACGTATAC
TTGACCTCCACGTAATTTCTTGCTGCCGCTGTCAAAGTCCGAGACAATCTCGCTGCACACTGCCGAGTGTGTGGACCCACACGAGACGTGCCAAACGCGC
ACCTTCTTGGCGACAAGCTCACGCACCAACGTAGGCACAACGACCGTGTCGACGACATTGCCAAGGCCCAGACGGCCGCCATTCGCGCACCCCCACATGA
ACAGCTCCCCCGTGGTTGTGACTGCACCAGTGTGAGCAGCTCCGCATGACATGGATCGGA