Description :
From Genome Similarity Track
Location :
Scaffold_31:27340- 30305
Transcript NameFunction/comments
Hyaar_Emoy2804696hypothetical protein

Sequence
2965 bases(100 bases per row)
GCCAGCAGGAATGTCCAGCGTCTCGGCGATGGACGCGCAAGAGTCAACGACAAAATCATCAGGGCCGTTTTCGGTCACGGCAGGGATGCGTATTTGCTCG
ACAATCGGTTCTCCAAAGTGGGGGTGTACTAAGGTCAGTGGGAATGTCAGCAGATACCGTTGCAAGGTCGACCAGCTTGATGGGACAATCGACAACGGCG
GCGTTTGTCATAGCGGAGTCAGGTGCTTGATCACCAGTTGATTCGCTCCCACGAGGTGAGCTAAGAGCAGCAGGGACGTCAGCAGACACCGTTGCAGGGT
CGACAAGGTGACCAGCAAGAACGGCTTCAGTTTCGTCGGGTTTGCACGCTTGATTTCTGGCTACCTCGTCATTGCGAGGTGAACCAAAATCAAGAGGGAC
GTTAAGCGACGCAGCGGCGATGTCGACAGGGTCGGCCGGGTGATCGACAGGAACGGCTTCAGTCCCGACCGTGTTGCATGCTTGGTTGCCATCCACCTCA
CCATTGGGAGGTGAGTTAAAGTCCGCGGGGAAGTCAAGAGAAACGGTATTGAAGCCGACCGGGTAGACAGGATGATCATCAGGAATAGCTTCGGCCCCGA
CAGGGTGGGGTGCTTGCTCGCTGGCCATCACGTTACTGCGATGCTTGCCGAGGTCCACGGAGACAGCAACGGGTGGAGCCGCCACGTCGGCCGAGTCGAC
GGGAGGGTCAGTCGCAGATTTTTCCGGATTCATCTGAGTAGGATCCGAGGTCAGCAGAGGTCAGGCCAACTTGGGGCGAGTCGAGATCACTGAGACCACC
AATATCGCCGGTCGCGTCTAGTGCATGACTAGCACGTCTTTCATCATCAAGAATGGGGAAGGATGATCACAGCGAGACCGGTTGAAGGGGAGCTAAACCC
GAAGTCAAAGGTAGACCAGCAGCGGGGTGGTTTGGAAGCGACATCTCTCCATGCTTATCAGTTGATAAAGATGCGATAGTTGAATGGAGTAGGTAAGTGA
GCAGTCCTCAGCCCTACCAGCATCGGTTGCCGATTACCGGAGCAGAGGACTACTGGGGTGTAGAGATCGGGAGAAATCCTGACCAATCGCATCTTTTCAC
ATCATGGATAGGTGTGGGACCGGTCACACCGGCCTCCGGAATAACCGCTTAAGAGCTCCAACGGTACGGTGGAAAGTTGATAAGTCATCAGTCGCGGTCA
CAGACGGTGACCAGCGGTCATGGTCACTGTTGACGACCAGCGGTCATGGTGACAGTTGAGGTGGGTTACTTCAAGCACAGGGAATGGATGGCGGGGGGGG
CGAACGACGTAACAGAAACCGAGATACAGAGTTCCTAATAGGTTAATGACGAGCAGTATTAATTTTCCTACAAAAGACACGCGTCAGCATCCCTTCGGGC
TGCAATACTTGTGGCCAATCGACGTTCAAGGTTTACTGCTTCACGTGTTTGCTCAAGGTTTGTCCCTAGATTGCTTGGCTAGGGACGAAGATACTCATTC
AAGTTAGCCTGCGATCGGACGCGGCAAGCATATAAATGCAAGGTCTTCAGACGGCTCATGTGGTCAGAAGGGCAAGGTGATCAAGTGGTCAGAAGAACAA
GGGGATCAAGTATCCACATTTGGGCAAGGCGACATCAAGGAAGGTCAGGGCGACTCTGGGAGAGAGCCACACGTTACTGTTGATCGTGTGAACCATTTCC
ATGCGACCACATACCACCTATCCCCAACTATGTCAAGACAGACATCGACCTCAAGCCACCTAGAAGAGTGAAATCCGCCCGCCGACGAGTACACAAGGTG
AGAAGGAACAAGACAAGACACAAGGTCCGGATTAACCCTCCGTTAGTCGGTCGTCCGGGCGACAGTGGAGAGTTGGAATCGCTTCGCAAAATGAGCGAAT
CCCTCACCACCACAAGAGTTTCACATACTGAAATCAAGTGATATCCCCAGATAATAAAGATGGGGATCAAGAATTCTCAAGACAACTCCAACTGCGATTG
AATGCAGCAAGAACGTAAATGATTAGGTGCAAGATCGCGAGACGGATCAAGTGGTCAGAAGGTTCGCGTTTCAAGCATCTAGATATTGGACTGGGCGATC
TCGTTGAGATCTGGGTGACTTACATCAAGTTATCTACCAGTAAACCCATGACCGTGTGAAGATTTCCGTACGATCACACCAACTTATCCCCAACATGGTC
AAGTTTTCCCTCGACACGAGTCCACTGAGAAGAGTGCAACCCGCCCTACTGACGGTTACACAAGGTGAGGAAGTAATACATCTACACGGTATCGGAGTAC
TCCCTCCGTCAGTCGGTCGTCTGGGCGCCAGTGGAGAGTTGGCATCGCTTGTAAAATGATTGATCACCACTGAACCACAATGGTGGGCGTGCCTGGATCT
TCTGGTGACTCGGGTTTCAACCGTGAGCCCCGTAGTGAAAAGGAGAAAATAAGGACGGAATCTGGGATGGAAGTGTCAGAGGCAGAGGGATCGCCGATGT
TGCGTTTTTAAAAGGATCCCCAGATTATAGGAGTTTTGAAGGCGGCTCTGATGACAGGAAAATCAAAGAGGAAGATCTATCGGTTGATCGGGATGAGAAA
CCTCCACCCCCTCCAGAGATCCTTTCGGGGACCACCGCGGATCGTGCCGCAAAGCACAATCTGCTGGGTGAAATCCCTTTGAATAAAACCGAACAGTTAT
TACTCAAGATCACTCAAGCAAAGTCATGAATGAAGAACGTGAAGACAGTACGAATGAAGAAAGAAGCGCTCAGATCGGATCAGCACGATCGCAGCTATTA
AATAGATCAATCGACCGATCAAGTTCATGGACGACAATATGAAGATCCAAGGCTGGCAGTTGGATCCGTTGGTGAAGGGATATCACCGGAAGACACTCAT
TAATTTGCTATCAAGTGACCCAGTGCTCCAGATTCTGAAGCCCAAGCTGATAGGAGAGATTAAAA