Description :
From Genome Similarity Track
Location :
Scaffold_2263:2734- 4476
Transcript NameFunction/comments
Phyta_totarag14302hypothetical protein
Phyta_totarag14303hypothetical protein

Sequence
1742 bases(100 bases per row)
CGGTCACGAGGATATCGTTAATATAAGATCGACGACCTAGCACTGACGCTTCCTTTCCTTCATCAGGCACCCCCTCCTCGAATACGTCGGTCTGGTTGGC
GTGATCTTGGCCGCTCGTGATCTTGTGCAACCCATACAACGCGTTGTCCACCAACCTCTGGTAAATCTGCGGCGCGTTATCCAATCCAAACAGCATTCAA
TTCCATTCGAACAGCCCGAATGGAGTAATAAACGCTGAGATCGCCCGCGCTCGATCCGTCATAGAAACCACCCAGAATCCACTAGCCATGTCCAGCGAGC
AATACCAGAGGATCTTGTCAAGATCATCGAGTAGGTCATTGATAAGTGGCATAAGATACACCATTAGTCGGGTCAGGCTGTTGATCAGGCGATAATCGAT
GCAAAGTCTGATGTCGACTCCATTCTTCTCGATGATCACGACAATCGGGGACGCCcatggcgacgtcgagtgTCGGATGATCTCGGCTGAATGTAAACCC
TTGATCAGCAGGAACAACTTCTCGCGGAATTGTGGAGCGACCTTGCGAACTCGCTGGGCTATCGGTCTTGCATTTCCCACATCGATGTCACAGATCGCTC
CCTTCGCAGGAGGTGGCAAGGCGTTCCCCTTCCCAATTAGAAGGTGTCGGCGACGCCAGATGATCTTCACTAGTCGCTCGATCTCTTCAGGCGTACTGTC
CTCAGGGTATTCCACCTGAATATCCTTAATCTTGACTTCTTCCGCCGTCGACGTGATCTCCGGTAATACCGCCATGTGACCCTCGAGATCTTCTGCGTAG
AGCTCACCTCCTTCCTTAATGCATACTTGTTCGACTTCTGCATGTTCTCTCGCGTAATCACTGGCGAGATTTTGTTTATTCGCGTCCGGGTCCTGACTCA
GTGTCTCAGGTTTTTCTCCAATCCCTGCAGATCGATCTTGAATGCGTTTCTGATTTTTCACCCATCTCTGCGCCTCGATCTTACCAATCACTTGAATGCT
GACATCTGCAATCACTTGAATGCTGACATCTGCAATCACTTGAATGCAATCTTTTGCATTCATCACCCTTTTTGCACCAGGGACTGGGCGTTTAATACAC
TCATCGACGCTGACTTGTACCTTCCCAGCCGGCGACAGACCCGCTTTTCTTCGCGTTTCTTCCGCTGTTGGGGCGCCTTCTCGCAGAACCCTTCGGTCGT
GTTCTCcgccatctccgtcgtcgccaccgccgaGCACTGCCACTTTTGGCGGCTGCTCCGGCGGCCGTGGCAAGATCGCAGTCGGAGTCTTGTACTGCGG
CCGATCTACGGCGGACTCCTGTGGTTCCTCAAGTTCCTGGTGATTTTCGCCGGTACCCACCGTCGCCTGGTAGGCCAGGTTCTACCATTCGGCATACCTG
CGCAATACCACCGAGACGTATCCAGGTAAGAGGGGGTATCCGATCTCCGGCCAGCCACATTCCGACCCGCATGTTGCGATCCAGCACTAACTTGCGATCG
CTCACGTTTGTTAGCTGCAGGTAGCGTGTCTTGCCAGGACCCGCTACCAGGGTAGGCACCCAGTGGTCTCCGCGGGTTAGCCACAGCTTCCGACTTTCTG
ctcgcagcttcagctccgcCGATcctccgacgtcgacgtaTCGATCTTCGTTCAAGGTCACCTGTTCCACACGCTTTCCGTAGAGTGGTCGTCTACCGGC
TAGCTGGACACGTACTTCGTCGGGGAGACAGATAGTGCCGTC