Description :
From Genome Similarity Track
Location :
Scaffold_407:2734- 4256
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_407-snap-gene-0.4F-box protein

Sequence
1522 bases(100 bases per row)
GTTTACAATGGATCCTGCTTGACGTTGAAGCGGCATTGTTTGAACGCATCAGTTGGTGCTAAACGAGCGAAAGCAACCGAAAAAATTCTGCATCGAGCAA
GTGAAAGCAGCAACAACCGAAATATGAAGTTCTGCAATGAGGCTACATGTGTGTCGCACTTTGTAATAAGAGGCCATCGCGTACTGTACTGAAGGGGAAT
CTTCCAGAGACAGGACATCAGAAAATGACAAGTTAGGTATGACGGTGAATCGTGGTGCGAGTGCATTTCGCAATTTGCTGCAGTTGCTGAAGTGTGAAAT
CAGTCAGTCCAAGGACCAAGTCGTATGCTGTGTCGTAGTCGTTGTATAGTGTGTAGATGTACTTATATCAAATAGGTATAGGTGGCATCCGCATAGCTCT
TAGCCACTCGAGCATGAGGAATGACTCTAAGTTATCCCTAGTGAGGTAAGCTATTTTTATTGTGGCCAATGTGTTATTTGTGTCGCATTTGCTTGTTGTT
GCATTTTCGTATGCACTTCTTCACGCGTTTGGCGAGCACTGTTCGCTGGGAATTGCTTATCCTCACAACCTTAATGGAAGACACAAAGAATGCGATGGGG
AGAGAATAAATCTTCTTGCAATAGCGTCGTTCAAAGTGCTATGACCAATTATCGGGATGAAGACGCAAGCTGTCATTTGGTGCGATCACAGCAGGAGCTT
CAGCATTCGAAAATTCTGATTGCATCCAAGAAGGTCAGCCATCTAGGCCCGAAGCCTGCGCTAATTGGAACCGCGTTCGGGCGAAGTGTCCGTGCAGAAA
GAGGGAACAATGGTGTGCTTCCGGAAATGCCAAAGGCGGAAGAGAAAAGCACGATATTGGCGGTGGCGAGTTTGGAATCAAATTTTTTGGTGTGTGCAGG
AACACGTGTGGCATCAAACAACAACAGTGAAGAATTTATGGAGGGTGCGTGTAAATGGACCCAAGATCAGTCTTTGCCGTTTGAGAAGGCGCGTGCGACT
TTGCTAGTCCGTTCTGATCCTTCCAAGAAGCAAGCTGCTGCGTCATCTTCGCTGAATCGTACCGATTCCGAATTGGAGCTTATAATCAGTGAACTTCGCG
AGCAGATTTCGCTTCAGCACCGAATGGAAGAAAGCAAACGGAAAGCAGCGCTGGCGGATCAGAAAGTGCATCCTTGTGCAAATTCTCATGTGGCTCTTGA
TTCGAGCCGTAGCACCGGTAGCAACTCGGAATCATATCTCCCGCATCATCCAAGGAAGCACCTCAAAAATGCAATCGAGCGAGTTCACGGCAACCAAGGA
AGTAGCGAGACAGACTCAGCGACTTTTTCCTCGCACGCTGCTTGGGAACGACAGCAGGCATTGAGTCATCTCAATACAGACAGCGCCATACAACTTGCGG
CACCCACCATCATTGCAACCAGTATTTCGACTGCATCATTACACTCTCGAACGAGTCTAGCACCATTGAATGGAAATTTGCATCCAAGCAATTCCCGTGA
TGGAGATACTGACGTGTACACC