Description :
From Genome Similarity Track
Location :
Scaffold_208:27334- 29177
Sequence
1843 bases(100 bases per row)
TTAGGATATTTGCGCTCTGTTTCCCCCCGAGTTACGATATAGAATCCTCGGATTACCCCTTATTGGACACAGCATGGAGACGACACAATCGCTCTCATAT
TAACCAGCTGGGGTATTTAGCTTGCCTCGTACATGTGAAAGGCTCGGTAAACGTGTTGATATGAGAATACAGCTCGGATCAAACCAGGAACAAGCCCGGA
AGAGCTAAGTCTGGCGGTCAATTGCATTGGGTCACAAGTCGGCGATGCGGCCTGCGTAGTGTGTGTTATGGGTGGACTCGATCACTGCGTGCGAGCCACA
CGGCTGAGATGCCGTGTGCTCTCTGGCCAATGGAACGCTGGCGTGTGCAGAAGCAGGCTTACAAACCGGTGGCTGCAATGCAGGATCTCGTAGATCAACC
AATCCGGTTAGTCTATGGAGGTTTTATAGCCAAAGGCTTTCCTCCGGAGTTCACAGTCACAGAAGCTCAATAAAACACGGTCGCCTCTGCGATTTGCATC
TAGCCACACAAATCGTCTCCTCTACCTACTTGCAGTCTCCTATGCTAATTTCCTAAGTGCTCAAGAGCCGACCCCAGGAAATTCTTAGTTGATAGGTCGT
TTAGGCTAGCCCCGATCGATATATATAAATCGACCAGAATGCCCAGTTATCCGTAGGCGTTCGGAAGGATTTACAAATATATCGACCAGGAATTGATAAT
GCCAAATCCATTTTTCCTTCTCAATCACCTGTGCATCGACATAGGGGCAAATCTTCGGCTGTATTTGTGATGGCCGTGAGCCGGCTACAGCTTCGTCCGA
GTTGCATGTTAGCTGAGCCTTAACCTATTGCTAGTATGTATCATTATGGAGGGTGAGGCGGGTGGTCTTCTGGCTTGCTTGACGTGAGGGGAGATGCCAA
ATGAGCTCAGCAACATCCCGTCGAGCTGCAGCTCTTCCTACTAGGCGCGTCTTCTGGGCCTGTGCGGGGGTTGCATAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGTAATCACCACAATAGAAGTTAGTGTTAACCTTGTAGACATTTAGCTGTGTAGCTTCATAAACGCTCG
CAAAGGTCATGTATCCCTTCGTGAAGTCTAAAAAGGATGAAGATCACTTTCTATTCTGTAAGAACTTTTGGCTTTGATTTATGTGTGATAGATTTCCAGA
TTTCCTATCAAGCTAGGGGCCAAATCAGCTAAATCTACGCGAATCTAGTAAGCTATTGAGCGGATATTGGGCAATAGCAGACGCACGCACGTTGACATGC
GAAGGTCATTTCTCTTGTACTGGGGACCCCCGAAGAATGAGGGAGTGGACACCTCCCGACGGATTAATTGCGTGACCGCAAGCGTAAGCGTCACCTGGTG
CAACCTTCCTGTCATTTTCATTTTCAGTGTGTTGTATATTAAGTTCGTTTAGCAAAGCTAGCGATCTTCAATAGCCTCCCCGTATAATGGTCCATACGCG
TCTATTCCGGCATCCGGGTGCTCCAGGAGCACCATCAACACTGCTGTTAGAAGTCGGTGTCTTGTGAGGGCTCGACGAGCTGACGTCTGGCCGGCAGAGG
TCACTGTTAAGCGAGGCGCAACCTTCATGCTACACTAAGGAGAAGGATGTCGGCCGAGCAGGTTCAACGGCAACTTTCAGCAAGAGAGATTGAGGCAGGA
AATGCACATCAACATCAACAGCCCCAAGCCCCAGCTTCAGACAGTGAACTGCGGCCAGCGTGATATTCATGGGTGTATCCCCGCAGGGCGTCCGGCCTTG
AATCACGCGGGCCATAGTTCTCTCTTATCACGGCAATTCGCAC