Description :
From Genome Similarity Track
Location :
Scaffold_83:27333- 28343
Sequence
1010 bases(100 bases per row)
CACGATATCTGATCGTGACGTTGCCCTGGACCAGATGCGCGTCCAGCTATCGGACTTGGCCTCCGAACGTGATTGCGCCATCCACTACCACCTTTCCCTT
CGGTAACTCATGGCATCATTGGTGACCAGAGTTTCTTCAGCCACGTCTGCCAAGTCGGGATCGTCTACCCGAAACCCTATATAGGCAGAGAAAAACGGCG
TCAGACACCTCGGAACTTGGCCTTTAACGACCACGCGATCTTCCTTCTTCATCCGACCCGCCCGTTCCCAAGCAGGTGAGTCGGTCCGCGACTTCCAGTA
CCGGCCTTCACAAGCTCGCAATCCTAAGTTTTCTCATGATCTCAAGGGTCGTTGCGATTCCAAGATTTCTCGCGATCCCAAGGGTTGTCGTGATATTAAG
GTTTCTCGCGATCCCCGGAAGCCCGCAGCTACCCCTAATTCGGGTAAACAGAGGCGTCGCGGTCCAGCTCTGCCCTCCTCTGAGGGGGAGGGATCATCGG
ACGGTGAAGAGGCAACGCTTTCGGCTTTGTCTGGTTCGCGATCTTCGACTCGTCGTCGTGCGTCTGGTCCGGCACCACAACCCTTGGCCGGATCGTCCCC
AGCTCCGATTGCTGTGGACACACCTATTCCTCCGCACGATTCATCGTCCCCGACTACCCTTAATCGTCCCGTCACAATCAAGGTGTCGAGCTTGGACCTC
CTCGAGGAGGCTTCAGCGACTCGGATGGCGCGATCATCCTTTCTGATGCACCCCGCGCGTCGGTGAACCAGGTGTTATCGCTTGCCGATTAAGGTAGTCT
GCCCCTCGTCAAAATTCCTCGTGACGAGTGGATACCTGGGTACAGGTATCGGGTAACTCGATTTTCTGCTCAAGCCACTCCCTGGTCGGCGCGAAAAGTC
AGCGGGACGAGTGTCGCGAAATTGGATGTCGATTTATTATTTCGCCACTTCTCCCGATCCAAGGGATATCCCTTTCCGGCATTATCTGTGCGCTAGATTC
CACCTCCCGC