Description :
From Genome Similarity Track
Location :
Scaffold_599:2733- 4219
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_599-snap-gene-0.8Gene of unknown function
Pytar_ATCC12531maker-par_contig_599-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
1486 bases(100 bases per row)
TGGGCAACGACGACACACCGAAACGCAAGCGCGGCCGTCCGCCCAAGAAAGACGTGCTCTCCCGCACCAAGCCCGAAGGCATGGAGAAGGCGCTCAAGCA
GTTCCCGTTGTGGGGCTACGGCATGCCGCTGCCGTTCTTGCCGGGCTTTCTGCCGCCCGGCGCTGCTGTAGGTGGTGGGGACCAAGCACTGGCCCAGGAC
GAGTCGGCCGGAAAAGATGGAGAGGACGACGCAAGCCGCATGGGTAAGGTCGGTGCCTCCAAGAAGAAGACCCGCGGCACGGGCAAGCCTCGTGGGCGTC
CACGCACGCGCCCTCGCCCGGGAGAGATGATTCGTCGCGTCAAGCCGCCGCCGATCGCACCGGCGAACTTCCCGGGTATGCAAGAGTACCTGACGCAGAA
GATGGCCGAGTGGAAGGCGACCCAGGCCGGCAACGCCGCCGACGATAACCGCGTGGTCACGGCGTTCGGCGCGACGCTGCTTCCCGGAGACCACGAGTAG
ACCTCCTGAACCGGACGCGCCGCCCCCCGACGACAAAGCAGCACGATCACGGATGTGAATGCCAGCGAGCGACGCAGGAGGAAGAGTGTGTTATCAGTGC
CCCGTAAACTAAATATGCTTTGTTTTTACTATATTCATGAGTGTTTTCCAACCTCTATTTCTCCATTCTCTAAACGTGTTTCTCTCCACCGACCAGTCGT
AGTAGTAATACACTTGCTTGTTCCTTTTCACCAGCTATGGGGCTCTAGAAGAAGACTTCTTCATCGCCGTCGTCGCTCACGGCGTCGCTGTCGTAATAGT
CAAACGTGTAGTCGTTCATGTCGTCACCCTGTATGACACACACACTCCATCAGCACAACCACCAGTTTAGAATCCACACCACTCCACCCAACGCACCAGG
TCCTCTTCCTGTTCGTCCACGCCGTCGTCGTCTTCATTGGCCGGCGCGTTCGCCCTGCCCGACTGTTCCTGCGCCTCGAGCGACTTGAACACTTGCTCAA
ACGCTCGCGGCTTCATGACCTGGCGGCCGCCCGCTACGCCCGCCACGCGCATGCCACTGATCGTGTTGGACCGTAGCTCCTCAGGCACGAACAGTTCCCC
CGTCTTTTGCGTCTCGGGGATCGTCACGTGCACAAACGCCGCTGGGTCCGTTGGGTCAGCCATGTTGGCACCACCGTGCTGGCCCCATGGGTGGTACAGA
TTATCGAGCTTGTGGGCGATCACGCGTTGGCGCTGAATCAGATACGCATCGCGGTCGTTCAGTGCCTCGGGCTGCGGTAGCTGCATCGGCGGGTACAGCG
CCGCACCGGTTTCGGCCTATGGTAGCATCAATCCACACTCGACACATCAGCGTCTTATCCACAAGAGCGCTCCATGTCTCTGGATGGGGGAACACGTACC
GCAAGCTGCTCCATCTGCGCATGGGAGAGCCCGAGATCTTCGCGTGTCTCGTCGAGAATATCGCCGAGCGCCGAGTCGCGGCTGCC