Description :
From Genome Similarity Track
Location :
Scaffold_89:27323- 30810
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.16Cell division control protein
Pytve_DAOMBR484maker-pve_contig_89-snap-gene-0.32Conserved gene of unknown function

Sequence
3487 bases(100 bases per row)
CTGACCTAGGGCTGAATACTGCTTTTGCAGCTGCACTTCCGCATACTGCTGCGTGTTCACGTCGTTGGCCAGGCGAGCCATTCGCTGCTGCAGCGCGACC
TTCTCGAGCGCGGCCAGATTCTCAAAGCACGCCTGCTCGATCGTCGCCGTCTCCACCGCAGCTACTTGGCTGCGCAGTGATGCCAGCGCCTGGTCTGCGC
GGCGGTACAAACCCCCGTTCACGAGCTTCGCCCGCTCGCTCAGCTTATGCGCGCGCTTGCTCAGATTCTGCTCGATCTCCTTCAAATCGTCGAACTCGGC
CTTGATCGCGCGCACCTTGTCCTCCTCAGCTGTCGCAAACTGGAACTGCGTGACGCCGCTCGCCTTAGATTTGTCCGTTTCCGCCACCGCAAGGTATTGG
GTCTGAGCAGCATCCCACTTGGACGCCACTTCGTTCACCGCGACTGACTTCCACACGTTGGTGTCGTTGTGCAAGCTCGCCTCGATCTGCACCAGCTGCC
GCGCTCGCTCCAGCTCTTCGTCCGAAAACTTCTGAAGCTCAGGAGCTGCCGCAGATGACGACGACTTCTTCCGCTTCTTACTGCTCTTCTTTGACACCGT
GGTTTCGTCCGGGTGCTTCACGATGTCGTGCTCCAGCATCAAATACATCTCGGCGACGACCGAAGCTTCCTCGCCATTCACCAGCGCCTTCTTCACCTTC
GTTGGCCGAGGCAACTCGCGCTGCACCGCGCTGGAACGACGCTGCAGTTCCAGCTCGCGCTGTAGCTCGATCATTCGCTGCTGACGAGCGTCGCGATCGC
CAGCATCTTCCTCTCGCAACCCAGCTGCATCGCCGTCATCTTCGGGCTTCTCCGGGATGTTGATTTCATACTCGTTCTGAGGAGCAGGGAGGCTGTTGAA
GCCATCGCGCAAGTCGGCAGCGAGTCGCTTCTCTCGCTTGCGCTCGGCTCGTGCGCTCACTTGCTGGTTGCTGTGCATTTGGTCGGGATTGATGCCCAGC
TCATCGCGCAGTGGAGTCCTCGTGGAACTCATAGGAGTTTGGTCGAGAGGTTGCGCCGCTCCTGCCAAAGGCGTCCGCGACGGTGTCACTCCAGTGTACC
CCGTGCCTTCAAACAGCTCAATGTTCTCCCCGCCCAGCAGTGGCGTCGTCTGGTTCCGCAGAGCAATCAGGTTCGCCGTCTCCTGCCGAATTGTGTCGTG
CACTGTACGGCCTTGAGACGCAAGTCCAGTCCCTGGAGTTCGCAGCGGCGTCGCAGTGTAGTCACCCATCAGTGAACGCGTGTCCGTCGCGCCAGCAGAG
CTTTCGAGCGCTAGCGCCGCCGCATGAGAAGCGTGCATCCCCATCTTGGCGAGCTCCGAGAGTTCGTCGTTGGACACGACAGGCGTCGGCAGTTCGAGCG
GTTTGCGCTTGATGGCGTTCAGTGGGTCGTTCTTCTCGTTCACAGACGCAATCAGTTGGGGAAGGTTGGACTTCATCAGCGACTTCTGCCGCTTGGCATC
CTGCTTGCGCTCCTTCTTCTCCAGGTCGTCGCGACGCTTCCCCTCGAGCTTGTCCAGCTGCAGGATGGCGCGCTTCGGATCGATCCCCTTGCTCGAGCGC
TGCTTCTCCTCCGTGACATCGTAAAATCCCGCAGGTGCGTCCTTCTGGAACGGGATCTCGTGGGCGTAGTCGATGAACTTGCGCTTCTTCAGGTGGACCT
TGCTCGACGTGATCCCCGCAGCCTTGAGCTCGCGACGCTTCTGCAACGCCGCCAGGCGACGCGCTTCTTCCAGCTGCTTCTCGCGCGCCTTGCGCTTCGC
CTTCTTACCCTTCGTGTTGGCGAGGCGAGCGCGGGCTTCCGACAGCATCTCCTTCTCGTCTTCGTCCATGTCGACAGGGTCGGGACGCGCCGGCTTGTTC
TCCGGGTTCGGGTCGATCTCGCCAGGACGAAGGCGCCGAGGGTCGTCGCTCACCTCCACGCCCTCCTTCTGCTGCGCAGCGTCCAGCAGACGCTCGTAGT
GCTCCATGCACTGCGCGGCCGTGCGGCCGACGATCGGCGCGATCGTGCGCCACTGCGACGGCATGAGCTTGGCGAGGTGCAGCAGCTTCTCCTCCTCCTC
CCGGCTCCACTCGGTTTTCTTGATCGATGGGTCCAGCCACTCGTACCAGCGCGCCTTGCACTGCTTGGCGCTCTTGCGCGCCAGCAGCGACGCCACGCGA
GCCCACTGGCTCATGCCGTACTTCATCACGGCCGCCTTGAGGATCTCATCCTCCGTGTTCTTCCACACGCCTCCCTTGATCATGATCCGCATGGTCGTCC
GCGGTGTCTGGTATCTGCCGACACGGCGCTCCCTCGATCACACAGGCTGCCACGAGCTGCAACGTCCCGCCGGCGTCGCGCTCCCCCACCGACCGGTGCT
CGCCTGCTTGGTTTCCTTGGTCGATGGGCCGAATCGGTCAAAATGGGTCTATGGGTTGATGGGTTTGCTGTGCAAGATTATGAAACCCGCGACCCGTTTC
GAGAGATCCAGCCCGTTTCCATTCCTGACACTCACTCTCATCGACTGTTCTCATCGACTGTGTATTCAATCATCAGAGTGATAGTCGTTCGAGTTGAACT
TGCTCATTTCCGTTTTGTCGGCATTACGGGATCAGAGGAGGAGAAGCAGCCATGGACGAGCGCGGACGCACGCTGCAGGCGCGCGTGCAGTTCATGGAGC
GTAACGGACGCGCGCTGGAGGAGCTGACGGCCAAGATGCTGCGCGCGCGGGAGGAGCAGGAGAGTTTCCTTGGCGTGTTCAGCAAGAGCCTGCAGGATGT
GGCCGCCCAGGAGGACTGCCGCTCGCTCTCTTCGTGCTTCGCGGCGCTGAGCGAGAGCGGCCAGAAGCTCGCGAGCGACACGCACGACGTGATGCTGCAG
CGTCCGGAGGCGGAGATCCTGCACAACATCTCGCAGGTGCAGGACTGGGGGATCATCCCGATCAAGGTGTGTTCGGTCGGTGCGTATTACTTACTGTGTT
CGCTCTCGAGGTTGACGGCTGGCTCCTACATGCAGCGATTGCTGGAGGACCGCGACAAGGTACTCAAGATAGAGGCGAAACTACAAAAGGAGTACGACGA
GCTGCGAGTGAGTCGTGATGTGTATTGCATTCGGAATTATCGTCGAGCATTTGATGCTGATTCCGTCGTGCCGTCACGAGCAGAGAGGCAGCTCGGCCAA
GGAGAAAGAGAAGAAACTTCGAATGCTTTCCGACCAGAGGCGTCGAGTGGAGAACGTCAACGGGCTCATCGACTATCACATGCAGCAGTTTGAAAACTAC
CGGACCATGAAGATGAAGGTGGTCCAGCGATTGCATCATTTCGTGCCTCCATCGCACTCACCGATTGTTGGTTCTGCCTGCTTCGTAGAAAGCTGCCAAC
GAGCTGGCGCGTTCTCATGCGTTTTACCACGCCAGGGGACTGGAGCTGTTCGCTGTGCCATGTCAATCTGCTGCCAACATCCAGCCG