Description :
From Genome Similarity Track
Location :
Scaffold_263:2732- 3868
Transcript NameFunction/comments
Phyta_totarag6373hypothetical protein PHYSODRAFT_486841

Sequence
1136 bases(100 bases per row)
AAAAATGGGATCTCGCCATGGGGCGTCACGCGAACAGCGTGGCGATTCCCCGGCAAGTAGTCGAACGTGGCGTAGTGAAACGTCGAGCGGTTGTCCCAGA
TCGCCACCGCATCCTTCGTCCAGTGGTAACGAACCTGGAACTCGTGACCTTCGGCGACGTGCTTGAAAAGGAATTGGAGCACCACGTCTACAGAGCGAAG
TACAAAGTCGTGAGTTAACCGCCATAATGCACGTTAAACGCGACTACATTGTCTGCACAAGGCGCGTAccagactcagcagcagagagaTCCTTGATGCG
TTTGGTGAACCCAGCATTCACGAAAAGCGCTTTGCGCTTAGTCACCGGGTGCGTGCGGACAACTGGGTGCTCAAACTCGACCACCGGGCGTCGGACGATA
CGCCCAGCTTGGATCGCATGGTCAGCTTGGCTCTGTGGGTATTCAACGCATGTCAGATATAACATACACACCAGGGCATTATCTCAGGTTGCCGTACCTT
GCCGCTGTGAACCGCAACCAGTCGTTCCACAAACTCCTTGAACGCAGGAGTGAGGCGGTCGTACGCTTCGTAGGCGCTGGCCCACAGCGTatcaccacca
acagcaggGCTCGTCAGCACTTTGAAAAGAGTGTAGGATGGAGGCTGTCGCTCGTAGGAAACGTCCGTGTGCCAAACGCTCACCGGATCGTATTTGTGGC
GCTTGAGCACTACCGCGCTCGTCTCCACCGAGTTCTCGACAACCAGCATCTCCGGGTACTCCTTCGTCTGCGCCAAGTTCTGCTGGATATGCAGAGGGCC
GTAGTAGCGACCAAGATCCAACAACTGCTCGGCTGAGACCCTCTGATCACGGAAGAAGACCACGCCGCGATGGGAGATAAGCAGCGCCAACTCATTCTTC
TGTACGTCCGTTagttcgtgcagctgcagaccCGAAATCTCGGTGCCGATCTTCGGCTCTAGATGCGTTACCGTCGCGTCAGCCAGCAGATTTTTGAAAC
TCGGGTCGGCCTTGAGCGCACGGTCTTCGTACGGCAGCACGGGGATCAGGTCGTACGTGGTTGGAGGGAAGGTTCCCAGCAGTTGTGGATGCTCGATCTT
TGCGTGCTTGGCCTTAAGGTTCAGTGCGTTTTTAAT