Description :
From Genome Similarity Track
Location :
Scaffold_2135:2732- 3809
Transcript NameFunction/comments
Phypl_g14719ATP-binding Cassette (ABC) Superfamily

Sequence
1077 bases(100 bases per row)
GCTATGCAGCTCTTTGCTCCGTTCctcgcagcttgcgctcTGCTATCCTCTGGCGTTGCCTACAAGTCCGGCGAGGAGTCCAAATCCATCGACGACCTGT
ATGCTGACGCTGTCGCCGAAGGTGGCAACCTCGTCCTATACCACGGCGGTGACACACCTACCCAGCAGGACGGGCTACACCAAGCTTTTTCGCAACGCTT
TCCCAAAATCAACTTCACTGTAGTGGTCGACTACAGCAAATACCACGACGTCCGCATCGACAACCAACTGGAGACCAACACGCTTGTCcccgacgtggtg
gcgctccaAACACTTCAGGACTTCACTCGTTGGGCCAAGACCGGTGATCTCCTCCCGTACAAGCCGGCCAACTTCTCCAAGGTCCACACGTCGTTGAAAG
ACAAGAATGGGGCGTGGTTGGCGTACACGATTTTTACCTTCGGGTACATCTACAACTCGTCTGCGCTCAATGGGTTGGCGCCGCCTGCCACTCCGGCCGA
GTTGGTGGACCCGCAGTATGCCGACAAGATTGCCTCGTCTTACCCtaacgacgacgacgccgtgctgttCCTGTATACTCGCTACGTTGAGAAGTACGGC
TGGGACTGGGTGGCCGAGATGGCCCAGCAGAACATTTCGTTCAACCGCGGTACAAACGTCGCCGGCGAACTTGTCAGCTCTGGAGAGAAGCCGATTGGCG
TGGGgtcgggcggcggcggtggctccATTGAGTTTGTGGGGGGCAATGGCACGGAGTACCTGAGCTGGGGACAGCGTGTTGGCATCCTCTCGAATTCCAA
gcaccttgctgctgccaagctgTTCATGAACTGGGCGATCTCCGAGGAAGCCCAGACGACGGTGGTGTTCAACAGTGTGCGCTCGGACCTCAACGCCAAC
AACCCTTGGGACACCCCGGAGGGCAACATGGCGACGTTCCCATTGTTCATGGAAGACcgcgccaaggtggagcagtGGAAGCAGACGTTCGCGCTGTACT
TCGGCGAGGTGCAGGGCGAGCCCAGTCCTGGATTCCTTGGTCTGCACCCCGGCCTTTGAATGGACCAGCTGATGAAG