Description :
From Genome Similarity Track
Location :
Scaffold_16:273160- 277839
Transcript NameFunction/comments
Sapdi_VS20SDRG_05951hypothetical protein

Sequence
4679 bases(100 bases per row)
GTCCTGCTGCAGCACATCGGTGGCCGCAACGCAATGCGCCGCCCAGCCATCAACACGCGCGTGCAAGGTGCTCTTCGATACGTACCTCTTTGAACCGCTC
GGGTGCGCCTCCCTCTCTCGCGCTGCGATCGTCGCCATCAGTCTCGCCGCGCTGCTCTTCCTCGTTGGGCTTTTCTGGCTGCTCGTGCGCTGGCGCAAGC
AGCGCGCGACCAAGACGTCCCAACGCTACGCGAGCTACTTGCGCTTGGAACGCCAAGTGCGCATCTTGGTCTGGAAGAACTTTCAACTTATCAAGCGCCG
GCCGTTCCGCGCGCTCTTCGAGTTGCTGCTGCCGCTCCTCCTTGTCGGTGCGCTCGTCGTCCTTGGCTTCCTTCCCACGTTTGCGGCCTCGTCGTCCGAT
GAGTTTTGGAGCACTCGGTCGAACTGCGATGGCGAGCTCGACTGCACGACTGTGTTGCTGTCAACGTGCTTGGCCAACCTCCCGCGGCTTCTCCAGACTG
GCGCGCCTTCGTCCACGTCGTCAACCTTCTACACGAGCGGGCAGCCGGTCTTTGGCATGTTCTTCCTCCTCTCGTACCTCCGCTTTGTGCCGTCGCTCAC
CTCCAAGATCGTGCTCGAGAAGGAGAAGCGGCTCACCGAAGGCATGAAAATGATGGGCGTCTCGGACTCGGCGCTGCGCGTCTCGTGGCTCCTTGGTGAC
CACGTCGTTTACACGTGGCTCGCACTTGCCATCGCGCTCGAGCTCAAGTTTGGCAACGTGTTTCCGATGGCCGACCTCGCGACGCTCTTCCTCTTCTTTG
CGGCGTTTGGTCTCTCGATGGTCTCGTTTGCAAATCTCATGAGCATCTTCTTCAACAAGTCCAAGACGGCGGCAATTGCGTCCGTCTTGGTGTGGGTCCT
CGCCTTCTTGCCCTTCTACGCCGTCGACGCCTCGTCGCATACGTCCAAGTACGCAGCCGCGCTGAGCGCCCCGACGGCATTTGCGTTAGGAATCAAAGTG
CTCACGCAGCAGGCGCAGCGCGGCACCGAGCCCTACTACAGCATTGCGTCGGCGCAAGCCACTGGCGGGAGCCGAGTCAGCGACATGACGTGGTTCCTCT
TTAGTGACGCTGTCGTCATGCTGCTGGCGTGCTGGTACTTTGAGCAGGTCGTACCGCAACAGTACGGTGTGCCCAAGCCCTGGCACTTCCCCTTTCATCG
CGCTTACTGGGCTCTACGGAGCGAAGCGCCGCGCCAGTTTCGCCGCCGGTTCACTGCGCGGTTCACCGACATCCCCGACTACGAAGCCATGTCGACACCC
TCGAGCAGTGAGGCATCAAGCATGCAGCAAGCCAACGTCGAGCCGCCGACGCAAGCGTTGCGTCTCAAGGAGCAGGCCGGCGAGTGCGTCCAGCTCGTCG
GACTCCGGAAAACGTTCAAGACCGACGACGGCGACAGCAAGGTTGCCGTCCACAACCTCCATGTGACCATGTACGCCGGCCAGATCACGGCGTTCCTCGG
GCACAACGGCGCGGGCAAAACGACCACGATTTCGATGCTCACGGGTCTCTTCCCGCCGACCAAAGGCACGGCCTACGTCTTTGGCAAGACGATCACGGAC
GACATGGACGCGATCCGCGCCAGCATGGGCGTCTGTCCGCAGCACGACGTGCTCTACGACGAGCTCTCGGTGCTCGAGCACCTCCAGCTGTACGCGGCCC
TCAAGGGCATTGACGACGCAAGCACCCAGATTGACGCGATGGTCGCCGAGGTCGGACTTGTCGAGAAGCGCCACGTCGCGTCGGCCAAGCTCTCGGGCGG
CCAGAAGCGCAAGCTCAGCGTCGCGATCGCGCTGCTTGGGAAGAGCCAAGTGGTGTTTCTGGACGAGCCTACCTCGGGCATGGACCCGTACTCGCGCCGG
TATGTCTATCGCGCTACGAATTGATAGATTGATAGTATTCTGCGGCTAGGTTTACGTGGAACGTGCTCCAGCGCAACCGCGAGAACCGGGTCATGGTGCT
CACGACGCACTTTATGGACGAAGCCGACCTGCTCGGCGACCGCATCGTCATCTTGTCGGACGGTCGGCTCTGCTGCGCGGGCTCGTCGCTCTTTCTCAAG
CAGCTCTACGGCACAGGCTACAACCTAACGCTCGTCAAGAACAACAGCTGCAACGTGACGGACCTCGTAACATTTGTGCGGCGCTTTGTGCCCGACACGA
ACGTGCTTAGCAACGTCGGCGCCGAAGTCGTCTTGCAGCTGCCAACGCACGCAAGTCCGACGTTCCCCGACCTCCTCCGCGCTCTTGACGACGAGTTGGT
GGCGCTGGGCATTCTCGAGTATGGCATCTCGGTCACGACGCTCGAAGAAGTCTTCTTGCGCATTGCCCACCAAGGCGACGTCAAGGGTCCTTCCGAAGCC
CTTGTCCATTGGCGTGAGAGTCAGCGCAACCTGTTCGCAAAGCCTCCTCGGGCAGCCGCCGAAGCAACGCGGCCGCCGTCGTTTCGCCACCAATACATGG
CCATGCTTCAGAAACGGTATGTCGATTTGCATCCTCTAAAGTCAAAATTTGTGTTGCAATTCACATCAACTGATATGATAGCTGGCGCGTATCCCGGCGG
GACAAGAAGAACATGGTGTTTACACTCCTCATCCCCGTGCTCTTCCTCGGGATGCTCGCACTTCTGCCGTCCATTCGAGTCGCGAGCTATCTCCCATCGT
ACGCGCTTGGCGTTAGCACAGAAGAGGTCGGCAACTACAGAGGCTGCAACGTCGTTCTCACCAACTCGACGACCAACTACGAGTGTGCCTACGGTATCAC
GCCTGCCGTGTGCCCCAACTGCCAGCCCTTCATGTACGGCTGCGAAGTGACCAACTACTGCTCGGAGGGCGACATCCGAGGCAACTCGTCGTACCCGTAC
TGCGCAATGCCCGGTGGATTTCTCCGGAACACCAGCGTCTGCGTCACAGAGTGGTTCAGCCACTGCTCGCTCGGCCTCGGCGACTGCGATGCATCCACAT
GCTGCGACGCCACGCAGCCGATCTCGCCGTATTATCCGTGCTCGAGCTGCGCATCCAACAAGTGGCCGTGCTACAGCGGCCGGTGCCTCGTCAAGCGCGA
CGCCAAGCTCCAAGGCCAGATCAACACCTTCCTCGCGTCGCTCATCATTGTCATTGGCTTTGCATTTGTGCCGGCGTCGATCGTTGTGTTTATCGTGAAG
GAGAAGGACCCGCACCAGAACGCCAAGTACCAACAGCTCGCTTGCGGCTCGTCCGTGTTTGCCTACTGGTTTTCGATCTGGACGCACGACGTGCTCTTCA
TGCTGCTGCCGGTCGGCGTCGCTGTCGCCTTGCTACCGTCGTTTGCGAGCTTTCAGAACGACTCGGCGTCGATTCTCGGCGGCCTCGCCCTTCTGCTGAC
GCACGTGCTCTCGATGCTGCCGCTCGCGTACCTCTTTACGTTTCGATTTACAAAGCACGCGGCCGCTCAGACGTCGGTGCTGGTGTTCTGCCTCGTCACG
GGCGGTCTCCTCAGCATCATCTCGTTTCTCTGCCGCTTGATCGACTTTGAGTTGATCAAGAACCAGCTCACACTAGCGCAGCTCGACACGCAGTACCTGC
GCTGGGTCTACTTGCTCTTTCCCGGGTACGCGCTCACGGACGGGCTCTTCCAGATTGGCATGCGCAAGTACGGGAACCCGTTTGGAGGCATGAGCACAGG
TTCATGTCCGATCGAACAGTCCTGCTGGAGTGCCAACGTTGCTGGTTGCTGCACAGCCAACTTGTTTGAACTGTCGGTCGCCGGGCGAAGCCTGTTGTAC
GGCGGTGTCGAAGCGGTGCTGTTTACGCTTCTAGTGCTCTACGCCGACCGACCGACTCGCGCTCGGCCACCGACCAAGGCCGACAACGCCTACCGCGAGC
GCGGAGGCTTTCTTGAGCCAGACGTGGCCGCCGAAGCGATTCGCGTCATGCAAGGCCGCGCCAGTGGCGACAACGTCGTCTTGCACAAGCTCCACAAACA
GTACGGCACCGAGAAGGTTGCGCTGCACCAGCTCAGCCTCGGCATCCCGAAAGGCGAGTGCTTTGGCTACCTCGGCATCAACGGCGCGGGCAAGTCGACG
ACGCTGCAGATCCTCCATGGCGCGCTGCAGCCCACCTCTGGCTCGGTCACGGTCAATGGCCATCAGTTGCCAACCGAACTCCGCGCAGCGCGGGCCTCGA
CCGGCTACTGTCCGCAGTTTGACGCACTCCACGACTTGCTCACGGTCCAAGAGGAACTCGAACTCTACGCGCGTCTCAAGGGCGTTGTGGACGTCAAGGG
CGCGGTCGCCGCCAAGATCGACCAGTTTGGCCTGCACGCGTTTGCAGCCAAGCGGACGCAGGGCCTCAGTGGCGGCAACAAGCGCAAGGTGTCGACGGCC
ATCGCACTGCTCGGGTCGCCGACGCTGCTGCTACTCGATGAACCGTCGACGGGGATGGACCCGGCCGCGCGGCGCGACATGTGGGACGTGATTGTCGGCG
TTCTGCAAGAGAAGAGTTGTTCGGTGATTTTGACAACCCACTCAATGGAGGAGTGCCAAGCGCTCTGCACGCGCATCGGCATCCTCGTGAGCGGGCAGCT
CAAGTGCCTCGGCACGGCGCAGCATCTCAAGCACAAGTTTGGCCGCGGCTTTACGCTCGACCTCAAGCTCGAGGCGCTG