Description :
From Genome Similarity Track
Location :
Scaffold_24:273133- 278804
Transcript NameFunction/comments
Physo_156634hypothetical protein
Physo_156635hypothetical protein

Sequence
5671 bases(100 bases per row)
GGCCTCAGCGTCGGCGGCACCGGCAGCGGCGCCCGGGGCAGCGGCACCGCCAGCGGCGGCTCCGCCCGTAGAGATGAGCTCGATGATCTTGCCCTCCTTG
GACAGCAGCGACGCGAAGAGCGTGGGCCAGTAGGGCTCCACCTCGTTGCCCGAGGCGTGCACGATGTGCTGGATGGCCTCCGGGGTGATCTCGTGCTCCC
CGTCGAAGAGGATCATGGAGGCGTACGCCACGCAAAGCTCGTCGTGCTGCTCCTTGGTGATCGTCGACATTCTTCCTTTTCGCTTTCGGCAAATAAATGC
CCCGCGGCTGGCTGCGTCCGCCAGCGCGGGCCTATTGGTTGGCGGCGAGCTGCTGTGCGCGTAGTTCGCGCTAGGTACGATTTGTGTCGAGCACATCGAT
ACTCGCGTGGTCCACGTAGATTGGTCGCGCGAGTAATTACGCTTTTTACTCACACGACCTTCGCGTCACCTGTACATATTTGATGTGTTGTACATAGTGC
CCAATTTCAAACAGCTCGAAGCGCGCCATCCTTCCGCACGCCGAGCCGAGCACCTCGACGGCGAGAAAGAGCGTCGGCATGCGCGCCGCCAGCGACGCCA
GCAGGACCACCAGCAAGTGGGCGTCTCGTGCATCGCTCGACCCGTTCGCCGGTGCGTCTACTGACCCGTTGGACGTCCAAAACGGCGCCGAAACGGCCGC
GTTATCGCCGGATCAAGCCGACGACGGCAAGGAGAACCGCATCCCGTCCAGCGGCCGCAATTGGGGCCACCCGAACGTCTCCATGAGTCGCGGACACCGA
CAATCACTCCTGGAGGCGCAGCTGCTGCCCCCAGAGCTCAATTTCGAGGCCTCCGCGCCGCTGTCGCTGCTCGGGAAGCGGCCGAACCCAGACAAGCGCT
CGCCCGCTGCCCACAGAGCGTCCCAGAGCGACGATGAATCAGATTCTGATACCGAACGTGCTGCGCGGAACCCGTGGGTAGCGTCTAATGCGGTGGCGCA
CTTCGAACAGCGCGCGCTGGAGCTCCATGGATCGTCGCTGGAGCTGGAACACACTGAGGACGTTGGCTCCGGCTCGGCCACGATGCTGGTGGACGACTTC
AGCCACTTGGGACAGCTGCGCTTCGGCGCGGTCCCTCTGGGCGAGAGGAGGGGCAGGCAACTGACGCTGGAGAATGCCAGCGAGCTGGGCAACGCTCGCA
TTAAATATGAAGGATACACTCTCGTGCGCGACGGATCGGGTGTGGAGAATGCAGCAGCGACCAAGTCGAGGTTTAAGTGTGACTTGCACGTTTGTGTGGT
GGACGCAATGAAGTCCGTGACGCTGAGAGTAACGTTTGAGCCGCAACAGGGAGATGTAGGGCGAGAGGTGACGGCCATGCTCAGGTTTACCGTGAACGAT
CGCTTCAAGTTGCAGTGCAGAGCCACTGGGTCGGTCACGCCGCGTGTGCCGAAGGTGGCTAGGTTCGGACGGTCGCGTCCCTCTCGTTCGGTGGATACGG
TGGTAGTGGTGTCGAGGGAGAAGCAGACGCGGCCGCCTAGGACACCTGCGGTGAATACCAGACAGATGACGTCGGAGCCGAGGAGTACTGCGTTCACCAT
TTCTAGCGCGTTGAGTGCGGGCCACCACGAGCCCGAACAGGAGCCTGTCGTCGTCAGGCCGAGAGCACAGGTTGGCGACAAACGCCCCTCATCGATGTCG
ATTGAGTTTTCGCCGCCTCGGAACGGACCGAAGAGAAGGAGAAGTGAACCGCGTATGGGTATGACTAGGGTATTGACGCCAAGGAAAATCCTCGGTGCCG
GACAAGACCCACCATCCGCGAAGAAACGTTTCTCTGGGTCCTGGTGGAAACAGCGCCAGGAGGTGTACGACGAGAACTGGATGGCAAAGCAGACTGAAGG
TTTCACGAAATGGATGAATTACGTTTTATTAGATGGAACCGCACAGCGTCTCAGTGGAGGCGATGCGGAGGATGATGCCGAGGAACAGGGCACAGGAGCA
AAGCGCAGGTTTGATTTCTCGTCGCTGCGGGTGCTGGCTCAGAAACGCATGGAGTCGAAATGGGCTCAAGCAGCAGTTGAATTATACCATTCTCCAAGCA
TGGACGACATTTTGTTCAATCTGCAGGATGAAATTGGCAACCAAGGGCTACTTTTCCGCGCCGACCGTCCTGTATACGCAGACGTTGGGCTACAGGAAGA
GCTCATTGGCCTGCTGAACAACTATCATCCCGTGTGGCTATGCTTGGGTCTCTACGCTGTTCTTGGAAACCAGGTCATGAGGCAAGAAAAGTGCTCGCTG
CGAACAATTTTCAGCATCACTACCGCGAAGGCTACCAGAAAAGGGAAACAAGAGTCGCCGCCAGACAGAAGGATGCCCCAAGTATTGCGCCGGATCATTT
TGAAACATTTGGTCAAGGATTCGCATGTTGCCCAAAATTATCGCTTGGTGAAAAATCTGTTGACCCCTATGGATGGTTCCACTGCGGACCGCAACGACGG
TGGTAACGCCTTCAAGAACACGAAGAAAAATATCAACGGCCGTGAATACTTCGACTCGCTGACGCAGTCTTTTATGTTGAAGTTCTTCATGCTCGTGATC
TTTTTGGATCGTGCGATCGAGCACAAGGCAGACAAATTCCCTCATTTTCCCTGCCTCTTCCGAGTTGCACCAACCAACAAAAAGACTACATCCAGTAAAG
CTTCGAGTAGCAGCAACGTCGGCCAACAGAACAAAGCCAGCGGTGCTGGTGAGGAGCTACGGGTGAAAAACTCGCAGGTGTTTGTGACCGAATTCTGCAG
ACTGTTTTTGGCAAGCGAGGGTCGTATCGACAAGCATTTGAAGCAACTGGGCTACACGCTGAGGCACGAACAGACGGCATTGGATGAGATTGATCTAGAA
ATCAAGAGTTTGGAGACAGACATGCGCGATGGTGTCCGACTAGCTAAACTCATGGAAGCACTCACAACCTCTCCGCCGACCCCTTGTACAGGTCTGGATG
GAGAGAGCGTTTCCAAGCCGAAGGGATTATCATCCTTCTTGCGCGTGCCAGCTCTGTCGCGCTTGCAGAAAGTTCACAATGTGGAGATCTGTCTGCACTT
CTTGCAAGATAAATGCGGTGCAAGCGTGCTGGATAACCTAAAGAGCAGCAGTAGCAAGGAAAGCAAGCACAAAATAAGTGGGCGCGTGCGGGTGTCCTCG
TCAGGATTTGCTGGTTTGCGCAGCAAGGTGGACGAGAAAATGATCGAGAACCTGGCGAAGGACATCGTGAATGGTCACCGCGAGAAGACTCTCGCGCTGT
TGTGGAAGCTCATCAGTTCTTTCCAGCTGCAATCGCTTGTGGACGCCCAGACAATGAAACGGGAAACAGAGAACGTTGTCAAGCGGATGAGTTTCCGCGC
GAAAGACTTTTTCGATCGTCAGCAGCGAAACGCCCCTCTCGTGCACGCTGATGAACACGAATGCTACGGGTTGTTGCTGGAGTGGTGTCGTGCCGTTTGC
GCCAATTACGATGTTGGAGTGGACGACTTCTCTCGATCTTTTGCCGACGGAAAGGCGTTATGCTACCTTCTTCACTACTATCATCCGATGCTATTGTCGA
AATCGGACATGCTGCCGACAACAACTGATTTACGTGACGAGGAGAATATCAGCGAGAAGATCCTCTTGTCAAATGAACAGCGGCATTTTGCTATCATCAA
CGATCGTATCAAGCAGCTTGGAGAAGTCCCGGTGCTAATGCCACAACAGTACAATACGAAGAACCCGCCCGAAGAGAAGATGGTCGTGACGTTCGTCTGC
TACTTGCAGTCACGCTTGATGGATTCCTACAGTGAGATTCACGCTGCATCGAGATTGAAGCGTTGGTGGAAGAGCCCACTGATTCGCTTGCGATTGCACC
GAAAGAAGAACATCAGTGCGCGCATCATCCAGCGATTCTGGTACACGTCCAGTCAGAAGCGATTGGCTATCCGTCAGTGCCGCAAACTCTTGCGAGCAGC
TCATCTCGTGAAAAGCACCTTCCAAATGTGGGTGGCCAGGATTCAGTTCCTACGGTTGCGAAGATCTGTGGTGGCCATCCAGCGAGCATTCCGTGCTCGA
CAGCAACTGCGCCTTAATGGAGATTCAGTAGGCGCTGTTCTTGTAATTCAGTATCGCTGGAGGAAGCAGCTGAAGTGGAGGCGCGAAAAAGAGCGGCGAC
TTCACGAGACTCGGCAACGGAAGGCCGCGCAACGTATTCGTGTGAGGGCAAGCTGTGCTATCATCGAAAGAAACTGGTTGCGGTATTTGTCCAGGGAGGG
AGCTCGTCTGGTACGACAACAAATGATCGCAGATCGGCACCTAGCTGCTACCCGAATTCAACTTGCATGGAGGCAAAGTCTCATGCGTGCTGCTGCACGA
AAGCAACGGAAGCAGGAGTGGCAGCTAGTGCATCGTGCATCTCAAGTTATCCAGCGTGCTTGGAACATTTTCCAGTGCCGCCGCGAGGCGACCCAGCGAG
CGCTGGCTCTACAGCGCTTTGAGCTGATGATGAAGGAAAAGGAACTCCAGAAGAGGCGAACCAAGCTCAAGTACAAGGTGGAAACACGTGCTGCAAAGTG
CGTCCAGAAAGGATTCCGTAAGTTTGCGCTGCGTAAGAGAGATGTGGCAGCTACAAAACTGGCGAGCGCATTCCGTGGTGCTAAGCAAAAGCTACAATTC
CGCAAAGAGAAGCATGCTGCTGTGGTAATCCAACGAAATGTCCGTGTTTGGCGTCGGAGAAGTCACTTTTCAGCGTTGACACAATTCTACAGTATGCTCA
AGACGTACCAAAGAATGAAGGCGAATGAAGCGCAACGGCGCGCATTGCGAGCTCAGGAACTGAAGTTTAAAGTGCAGACGCGAGCAGCACTTCGCATTCA
GGATCTTTACCGAAGTTACCGATTCAACAGGAGAACTTCGGCAGCGACAAGGATACAGAGCTTGGTGCGTGCTCGGATCGTGAGGAGCTGGTATTTGCAC
TGCCGTCGGAGTGCGTGTCTGATTCAGAGGAACGCACGGATATGGCGTCGTCAAGGACAGGTTCGAGCATTGCTGGTGTTCCAGAACATGCTCTTGCGAT
ATCGATGCATGCAGCAGCAGGAAACACAGCGGCAAGAACGTATTCGCCAGGAGCGGCTTCGTCGCCTTCAGGAAAGCGTGGAGCACCGTGCAGCGTACCG
TATCCAGTCTGTGTACCGCTTTTATGCTTATCACAAGAAGATGCTGGCGGCTACGCTTATTCAGGCGGCATTCCGTGGATTAAAGGAGCAGCAGCAGTAC
GCCAAAGTGCGTGCAAGTGTCGCTAAAGTGCAGCGTGCGATCCGTTCTTGGTTGTCGATGACAAGATTTCGACGGGCTCTCTTCGTGCACCGCGCAGCAG
TTTGCATCCAGAAGTGTGCACACGGGTACATTTCTCGCCATCGCCGATTTAACTTTTACGCTCTCCAGACCCAGCTTCAAAGGCTGCGGGTTTTGATATC
ATGCTGGCGGATCGAGTTCTGGTTCAGGAACCGCATGATGAGGTACCGTAAGAAACGCGCTTTGATTGTGCGGGCTCGTTGGACGCGACTTCGTGCTGGA
ATTGTGCAGAAACGTACCTCGGATGTTCACAAGATTACGAGAAGTTGGAGGTCGTTCTGCTTGAGGAGTGT