Description :
From Genome Similarity Track
Location :
Scaffold_418:27305- 28403
Transcript NameFunction/comments
Phyta_totarag8120ribosomal protein-like

Sequence
1098 bases(100 bases per row)
CCCGGTGGCTCGTTACCAGGACGAGCGCCGAACAAGCGTCATGACTGGCATGGGCGACATagtcgacttcttcaacagTACTTTGGTCCCGATTTGATAT
TTGATGACGTCGTTTTCCGCAGACGATATCGAATGTCTCGCCGTTTGTTTTCTAAGATTGCAATCGGTGCATTGGATCATGACTCCTTTTCGTTCAGAAA
TAAAATGCTACAGGCAAGGTCGATATATCAAGCCTCTTAAAGGTAACGGCTGCGTTGAGAGTTCTTGCGTACACGTCATCTTTTGACGCCATCGATGAAA
ACCTCGAGATGGCTGCACCGACTGTCAGTGCATGTGTTGAGCACTTTTGTGAAGCAGTCATTGCTGTCTTTGGCGAGGAGTATACGCGCCCACCACGACG
AGATGAGATGCTACGGCTGCTTGAACAGAACGAGCGCCGTGGATTTCCTGGTATGGTAGGTTCAATATGCATTGGGTTTGGAAAAATTGCCCTATGGCGC
TTGCTGGACAGCATAAAGGAAAAGAAAAAAAGCCAACAAAGGTTTTAGAGGCTGGTGCTGATTACGATTTGCGTATTTGGCACTACAATTTCGGCTCACC
AGGCTCATTGAATGACATCAATATCTTAGAGCAATCTCCTCTATTTGACAAGATGCTCCGTGGCGAAGCCTTGCAGGTCGAGTATTCCATTAACGGTAAG
GCGTTTTAATTCAATTATTAACACTAACTGGATACTAACTGTAAATGGATTTGCCAGTCAACGTGTACGACACGCCGTATATGTTGGCGGATGGAATCTA
CCCCGAGTGGTCGGTTTTTGCGAAGACCATCGAGAAACCTCTCGGTAACAAGCGCAAGAATTATTCCAAACAGCAGGAATCATCCAGAAAAGATGTAGAG
AGGTGCTTTGGTGTCTTGCAAGCGCGCTGGCGGATTCTGGATACGCCGTCTAGGCTGTGGAGTGCATACAAAATGGACAAGGTGATGCACGCGTGCATCA
TTATGCACAATATGATCGTGGAAGATGAACGAGAGCCGCGAGAAATGGACAGATTTTCATTTTTGTTTGACACTCGCAATCAACCAGGAGGAGTTCCC