Description :
From Genome Similarity Track
Location :
scaffold_13:273033- 274475
Sequence
1442 bases(100 bases per row)
GAGCTGTTACAGCTTGAGAATGTGACTTACGATGATTTCCCACACTACCTCAAGTGCGATATTATTGCGAAGGTCGTGTTGCTACAGTCGAAAGTCGATT
CATTGGAACTACACTCATCATCATTTATGAATGATTTGGTTCTCGAAGAATTTTTACAGCGTATCGAATCACACAGAGGGTCTGCCGTTTTATAAGGTCC
AACCAATCCTTACTCTTATTTTATACAAGGATGACATCCTTTGTGCGAAGCCAGCTTCTAGTCTTCCACTCGAACTTTGCGTTGGACACGAAATTGATCG
TGAACCTGATTCAAATCATGCAGTGCGTCGACAGTGGCCATTGTCGCGTGGGCAAAGTGAGTATACCGATGAGTTCTTTGCTCAAAGCAGGCTGCTAATT
TGGTGAGGAAGATCAAGTCCCCTCACAGCACACCGACTTTTATTGTGCGCGAACCAAATGgtaaatggcgtatcgttcacaccTATAACAAATTCAATGC
GCAGATGATTCCTGCGCAAACGCTAATTTCACGAAATACTGTATGTCCGGTTGTACACAGTTTAGTTTacttgatttggtcgatggatacTATCAAATCT
TGGGGAGAGAGGAGGATGTCCCTTCGACGGCTGTTAGTACAACGTCCGGTATGCTATTGGAGTGACTTGTGATACCACAGGGACTATGCAATGCCCCAGC
AACGATCAATCGATTGGTCTCACCACTGCGACGCTTTGCACcaacatactttgacaataTTTGTTTCGTTTACTCGAAGGACGAAGATGGCAGATCGGCC
GGCAAAATGCACTGTAGCACCAGCGtgcggtgctataatacatgCGTGAACATTTATTGCAGGCGAATCTTGCTAAGTGTATTTTCTGTGCTAAAGACGT
ACCGGTATCCGGTTGTTATGTTGGTGAACACGGTGTTCGTGCGAACTTTGAAAAGGTCAAAATAAACGTGGGATGGCCAACGCCACGAAAGCAAAAGGAT
TCGAGTAAATGTATTGGTTTGTCTTATGTACGCGGGAGAGGTACACCCGCTATCAAATTTACTGAAGAAAGACGTACCATGAAAAGGGTAATCTACTTGT
CACTCAAACAAAGAAAACTTGATGGAAGCACAATTATTTGCCTTAATAGATGAGACGAAGCCGTTTAGCGTggttttgtgacgcttctgagtTTCCAATC
GGTTATGCTTTATTGCAAAACGACTCAGAAGGACACGTGTCGTGTCATTtaatcgcgacagctgaagccaGCAGAAAGGAACTACCCTGTCCACTACAAG
GAGCATTTGTCAATCAAATATGCTCGGGTAACGTTTCGTGTTAAACTCTTGGGTTCAACTCCGATTACTGTCTACACGGATCTAGCAAACGTACATTATG
CATTTCAATCGCCTCACTTGCCACAGCAAATTGCTTGCTGGC