Description :
From Genome Similarity Track
Location :
Scaffold_1309:2730- 4823
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1309-snap-gene-0.6Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_1309-fgenesh-gene-0.3Sodium/glucose cotransporter

Sequence
2093 bases(100 bases per row)
TGCGACTTCTCGCAGTGGCATCCACGAAGATACCCGGCCTACCATCTCTCCAGCACACGGACGTCTGCGCTGACGATCGATGGGAAACTGGACGAGCTCG
CGTGGGGAGACGCGCCGTGGAGTGAGCCGTTCCGGGACATCCGAGGACCGCGCTACTGGTCGCAGCCGTGGTTCACCACCCGGGTCAAGATGCTGTACGA
CGACGAGTTCCTCTACGTGGCGGCGTACCTGGAAGAGGATAGCGTGTGGGCGAACGTGACGCGGCGCAACGACGTGGTCTTCCACGACAACGACTTCGAA
GTGTTCGTCGACCCGGACGGATCCACGCACAACTACAAGGAGTTTGAGGTCAACGCGATCAACACGACGTGGAACCTGTGGCTGAACCGCCCATACAGAG
ACGGCGGACACGAGAACAGCACGCGCATCGATCCGCAGTTCGGCTTTGACATGTTCGGCAAAGGCATGAAGTCGGCTGCTTTCTCTGTTGGTCCGCCCAA
CGAACCGCGTACGTCGACTACTTCGCTGCATGTGATATCGTCGATGTTGTCGAGTATGCTGATCTCTGTGCATCGGCGCCAAATGGAAATGATGTAGGTG
AACGGCTGCACTTTTGGACGACAGAAATCGCATTACCGCTCAAGGAATTGGCGTTTCACACCAAGGCTACGACTCCGCCGGCACCGTATTCATTTTGGAG
GATTAACTTCTCGCGTGTCGAGTGGTCGGTGCAGATTGCAGCGATCTCTTCCATTGGGAATGAGGACGATCACGGGAAGTGGCGATATGAAAAGATCCCG
GGCACTGCGGAAGAAAACTGGGTGTGGAGCGCACAGTACGCGGTGAATATGCATCGACCGGAATGGTGGGGATATCTGCAGTTCCGCTCGGCAGATGAAC
AACTGCCACGGAACGGCGATGCTACGGTGCCTCTGGATCCTGAGTGGGACGTAAGGTATCTCAGTTTCCAGTTCTACTACGCTCAGCATCGTTATTTCGA
CACGCACCACGAGTTTGCGTCAAGTCTAGCCCTGCTCGAGCCATTCTATGAAGCAAATGACGCTTACGAGTGCACCAACTTGGATGGGTTCGAGAGCACC
AATGACTCGTTTGTCGCTCGTATTGAGAGAAAACAGTCAATCTCAGCTGCCGACTTCACAGCCACGATAAGCAGCGATAGTCATATCACCGTCAAGAAAC
CACAGTCTGTTAGTGCTGCATACTCGTAATGTGAACGGATTCCGACAAGATTTTACGGACACTCAGTTTGAAACCACAAAAGAGGACTGCAACTGTAAAT
GGGGGACGGCGTACTTGCTCATGACAAAATCTAACAGTGCAATCGGTGTCCAATCAAAATCGATTTGATATTTCGCCATCTTTTGGCGCAACAGGAAGGA
TTCTTACACTACAAATACTTGTCGGGTGACGATCTTGGGATCATATACTCCAGTCTACCACGGGAACGTGATGAACAGCGCGGCCATGCAGGCCATCGAG
AGGAACGCGCCGACGATGACAGTAACATTCACCCACGTCGGCTTCTTGAGTTCGGTTGCGTCGAGCTTGAGCACCGTTTCCCACTGGATCGTGTACTTCA
TCGCGTCTTCTGAGGGCGGCGGCGTCAGCAAGCTCACGACGACGCACACGATCATCGAGAAGACCCAGAGCAGGATCGAGAAGTGGTAGAAGTTCATGTA
GAAGAAAGCCTCACCGAAGCCGGACAACTTGCCCTTCATGCTGTCCTCCTCGATCGTCACGAAGATCAGACGCACGAGGCCAAGGATGCCGCCCGAGACC
AACGCCCAGAATGCGCCAGGACCGTTGATACGCTTCCAAGCAACGCCAAGAATCAGTACGATGCCGATCGGCGGCGTCAGGTAGCTCTGGATCTCGATAA
TCTTCTTGTACATTCCCTCACCGTTGCTCAACACGGGGATCCAGCAAAAGCTCAACACCGCATACGCAACAATGCTCAAGCGACCGACCCACACGAGTTG
CTTGGTCGTGGCGTTGGGGTAGAACTTGAGGTAGATGTCGTTCGTAACGACCGAGGATCCGGCAGCAAACACCGAGCCGAGACTCGACATCAT