Description :
From Genome Similarity Track
Location :
Scaffold_1300:273- 1974
Sequence
1701 bases(100 bases per row)
CAGAGGTGCGCCAGCTTCTTAGCGTAGCCGGGCTTGACCTGATTCACATAGACCCAAACGTGTGCGCCTGGGACGATCGTGTCAGAGTCGCCTCGCTGAT
CTTCATTGGCTCGGTCCCtCCGTTTTTCCATGGCTTCTCGCAGCAGCCGGCCGACTTCTTCTCTCGCCCGCTGGTACTGCGCCTGCACGTTGGCTCTCCA
TTGGCGGGCTTCGCGGTGTCGCCCCTGTCCTTCGGCTGTGGGCAAGGCGACTTCAATTGTCGTCTTCGGCTCCCACCCATGTAGGAGGTAGAACGGCGTA
TCACCCCGTACGCGATCGTAGGCGGTGTTTACGGCCAGCACCAGCCGCTTGGCGTAGTCGTCCCAGTCTTGCTGGTTCGGGTCGGCTACGTACAGCTTGA
CTGCCCGCGAGATCGTCTGTACCATCCTTTCAGTCATACCATTGGACTGCGGCCGATATGCCAGAGTCGCCTTGCTCCGTGAGCCTGAACACTTCTGACA
TGAAGGCCGGCTCGCGGTCGTGTCGTATGATGTCGCTGGCTCCAAACCGCCTGTAGACGGCTCGCTCGTACGGTTCGGCTACCTCCTGCGCGTCTCGGCT
CTTGTTTGCACTCACGATGACGAATCCAGAATGCTGGTCTACCCAGAGCAGAAGCTCCGTGTTACTTCGATGCGACTTTGGCACCGAGGGGGTGTGGTCC
ATCCCCAGCACCTGGAAGGGCCGCGTAGCCACTACGTTGCCTGGACTCGAGGTGACCAATCTAGGTGCACCTTTCCCTGACTGGCAGTCCGTGCAGCCGA
GCACGTAATCGCGGACGTCTTGATACTGGCCCCGCCAGTATAGCAGCCTCCTCGTCCTGTCGTACGTCCGGCTGACGCCTTGATGCCCACCGTTTATACT
CGTATGGTAATGGTGTAGCACCTCTCGCACCAACGTCGAAGGCAANNNNNNNNNNNNNNNNNNNNgCTGTTGCTctCCGGCGTCTTTGCTGCCACCGTCG
CGCGCCTCCGGGCGTGTCGTCGTGTTACCGTGTTCGGCTTCGGTGCCATCATCTGCTCTGTTCACTTCGTTCGTGCCACGTGGCACCCGCTGATCATCCC
CTTCGACGTCGCTTGCAGCCGTGTCGTTCAGCCCGACGCCTTCAGCTACACGCTCTCCACAGGCGCCTTGCGCTGCGGCGTCCTTGCGTTGCTCCGTGAC
CTCTTCATGCTCGCTGTCGCGTTCGTCTGGTGTGTTGAGGTGGACACGCTTTTCCGCGCCCCTGGCGTCCGTCGTGCTGTGGTCTGTGACTGACTCGCTC
CCTGTCCCACTTCTGTTTACTCCAGTGTTTACTCCCGCATGGCGTGCGGCGTCATCACCTGATGTGTGGTCGAATGTACCCATATCAGGCACGGGAGTGA
TGGTAGTAGGTGGCGGAATGGCTGTATCGGGACGCTCGCCGTCCGTCATGCGCCCACTtCTCGTCACAACCTGTATCGACGCCGGCCGGTTGTCAGCCGT
CTCCGCACTCGCAGCCAGCGCTAGTGGGAGGCGGTTGAGCAGCTCCATGTCCGGATACTCGCCTCGGCCGACTTCTCCTCCGGCTTGACACTGAAGGGCC
TTGCCCGTGATCAGATCGGCTGACGCGTTGTAGTCTCTAGTCACCTGAACCAGGTGAGCGCCCCTGAACCGGCTCAGTTTTAGCAGCGCCcTCTCACGCA
G