Description :
From Genome Similarity Track
Location :
Scaffold_1143:273- 1352
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1143-snap-gene-0.4Phosphatidate cytidylyltransferase

Sequence
1079 bases(100 bases per row)
NNNNNNNNNNNNNNCAGACAACGCCCATGCCAACATGAATAACAACAACAAGGGCAGCTCACACGTGGACGACGATCTCGACATCAGTCCGCGCATCAGC
AGCAGCTTTGTGTTCGACACCCCACAAGACGGCGTCCGCAACCTCCTGCACCAGACGTCCATATCGAGTCCCGTTATCGTACCGGAAGTGACGGCGACTN
NNNNNNNNNGAGTCCGACAGCGAGATATACATCGAGGACGTCGACACGGCGTTCTGCGCGGTCTCGGGGATCGCGAACAGGTTCTTCAAAGGTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCCATGCTATTGTCGTTGGCCACGACGCTCGTCATGTCGACGATGTTCCTT
ATTTTTGCGCCGTGGATCCCCGAGCTCGAGACCACGGAGCTCTACCGGCTGCGCTGGTTTTACGCGCTCGCGACGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCGTCGTGCTCATCCTGCTTTTCCGGCTCAACACAAGGAGCACGAG
TGGGTTGGGTGTGTTTCTCCACATCGTGCTCGACATGCTCGGGTTCCTGTACATTGTCGGCAGCTTGTCGGTGATCGTTGCGTTCGTCGACGATGACCAA
CTGGAATCGTATCGGAAGCTCCTNNNNNNNNNNCGCTCAGCGCGTTCTTCACGCCCAACTGGAAGTACGCCGTCATCTGTCTCGTGGAAAAGTCCGTGTT
TACGCTGTTGACGCTGCACTCGACAATCTGTCCGATCAACCAGTTTGGCTGCGGCCTGTCGATGGAACCCGCGCAGGTGTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN