Description :
From Genome Similarity Track
Location :
Scaffold_255:27285- 29234
Transcript NameFunction/comments
Albla_Nc14108810palmitoyltransferase putative

Sequence
1949 bases(100 bases per row)
AGGATGCCTCTCCGTTCTCATCCAAAACGAATTGTCAGGTTGTGGATACGAGACACCCGTGGCGGCTGATTTCCATTGATCATAATAATGCAATGAGTAT
TGAGTAAACGCTCCTGATTGTGGGTTTCTAGTCGGCGCAAATGTGTTTGTGTCTTGAAAAGTTGATAAGAATGGCGTCGCTGAGTCGACGTGAGGAGAGC
TCTGCATCGAAATTGCATCCAGCCAATCACATGTCCGTGATGCATCCATTTGAATCAATCAAAAAAGGTTTTTTGTGTCATTTCTCCGGTATGTCTGAGA
GTACTCGGCACATCACTTTTGAACAATTTATCAGCACGAAATATGATAACCGCAACATTTTTGATGCATGCACCCACGGAGACTTTCCCCTCGTCGTCCT
TCTTTGGGGAATGGCAATGGCGAATCCGTCATTGAATCATTATGATTTGTATAACACGAGCGACGAGAATGAAAACACGATTTTACATTATGCAGCCGCA
TCCCCGTCCGATTCTGTGGACATATTTCATTTTCTCATACAACAATTGCAAATTTATGTTCAACAAGTTGGTGGGCTTCAGACCGTTCAAAATGATATAC
TGAATGCGCGTAATACTGCAAATGAGACTCCATTGATGTAAGCACTTTTCTTACTTTGCGTGGAATTAATTACGTGATTATAATGTCGCAAGCCGAGCAG
CCCATACCGGGAATTTGAGAGTGGCCTATAACTTCTGTATGATCCCCGATGTGGACATTTTGGCCGCCGACTCGCTGGGAAACACTGCAGCTCATCACGC
TACCGCTATGGGTCACATAGATACTTTACACTTTTTATTAGAATTCGAAAAGTTTGCAAGAAGCGAAGGATCAAAATTCTTGCTGGAGAATTCAGCTAAA
CCTCTAGGGGGAATTGATGAGTCTGGAAGAGACGTTCTTCATCATGCTGTTGAGAATGGTTTGTGTCGTCGTGTTCAAGTGTGTCGGTATCTTTTATACT
TGTACGTCTTTAGATCGAATCGTGTTGGCCCAGTATCTGTTATCACGTGGAGATTACGACATTATGCGCGCTGACGAGTCAAAATTAACTCCCCGGAAGA
AGGTCGAATCAGCACCGTTGATGCGAGAACTGGACCTTGATGCCGAGAGCCCCTTCAAGGTTTATCAAATTGATCTCACACCATCATCTACCGAATGTTT
CTATGATAGCTTCCACGATGCCGCTCGACACGATGGAGTGTTCTTGTAATTTGGGCGTTCCCTTTGTCATTCGTTCTTTGCTTGTCATGTTGGTTGCCTT
GTTATTTGGCAGTGCCTTTGGTTGCACTTATCGTCATAAATTATTTCCAAGCTTTACAAAAACGGCTCAAGCGGCATTCGCGTACTGGAGCTGCGATAAT
GCATTCAGCTTCACTTCATCCAGCGAGGAGAACGATATCGTTCAGTCCTCACGTCCAAATTTGCCGCCCAGTATCTACAGATATGGCTCAAGAGCAAACA
TCAACTTTACATTCTCTATCTTTATCAAAGCTTCGGTATACGATTGCAAATCCCCCCTATGAGATTGGTCCAGCTATATGGCTCGCATGGGTTGTCACAT
TCAATTTTTGTATTGTCATCATCCTATCGAAAACGACCTACCGGAATAGTTTGTCATCGCCACCCGTTTGGATACTGTGCTGTGGACTCGTAGCGATGGA
GCTTCCTTTCTTATGGCTCTGGTTTAGATTGACGTTTGCTAACACAATTGATTCCAGCCACATCGAGAGTATTGCAAAAGACCTTCCCTACGTATTAGAG
ATATATGCAAAGCATGGAATTCCCATAACAAGCGGCGAATCTCGACTATGCACCACTTGCTACGTCAAGAGGCCTCTTCGGTCCAAACACTGTGCATCCT
GTGGAATCTGTGTTGCCCGTATGGATCACCACTGCATTTGGATTAACAG