Description :
From Genome Similarity Track
Location :
scaffold_250:27283- 29564
Transcript NameFunction/comments
g6313.t1 hypothetical protein PHYSODRAFT_553661
g6314.t1 hypothetical protein PHYSODRAFT_553660

Sequence
2281 bases(100 bases per row)
CTGCTCATGATTCCTGAAAGGTGCAATTGGTCGCGGAACTGACCGAATGTAGGCATGAAATCCTTAGCCGCCGGTGGGGTAAGAGCGAGCACGACGGCTG
GCTTCTTGTCGGTAGGTTTTTCGTGGGTTTCTGGCTCGGTAGGAGAAGCTTCAGGCACTCTTGATGCCAAATGCGTTGGATCAGCAGGATCTTTGTCTTC
AAGATGGCACTTGTCGATCGACAGGAAAGCCACAGGCGCGATGTAGTCATCCGAATGAAGTACCGTGTGGCTCTCATCACTTCAAGACAGACGAACACAT
GATATTCGTTAGATTCTCGAACACCAAAAAATTACATCCCGGCTCCAAACAAACTTACATGGCAATGCGTTTTTTAAACAACGGGCAATCCAGCGTGAAG
GTCTCGTATTCTCCACCTTCACCGCAGACGTTCATCTGGTACTTCTCCTTCTGCAAAAAGACAGCACACCGTAAAATAAGCAAACGGTACACTCATAAAT
CAAATCATGGCCGGAAGTTTACCAGCATCATGAATTGCGGCTGCAGCTCAGCAATAGTCTTGCCCAAATGCCTCCTTGGCTGCAGGCCAATAGACGCAAC
TTTGACCAATATGGCCTCCATTTCCGACTCGATCATCTCCTGCAGCAGTTCAGTCTGCTCCCGTCGCCACAAGTATCCAAGCGACGTCAGTCCCAGCCTT
GAGCACCTGTTCAAGCGTTAAACGTCAGCTTTCTACACTCCACAACCAGCTTCTCATTTCACGTACACATTTTCCACTCTGTTGCGCTGGTAGCTGGAGA
AAATAGCGCCAGTGCAGACGCCCTGCACGCCCGGGAACTGCTGCTTGACCTTCTCCAGCAAGCGGAACAGATCCTCCACCTCGTCTCCGGCTGCAGACTC
GTGGTAGTCGATCTCCGTCTTCACTGCAGTTCCCGTGATGGTCTCTGAGACTAACGGTAGTTCCATACTCTCGGCAATGAGCCCTACAGTCTGGTGACCA
ACACTCTGGAACATGAAAGAGTCGATCTCCGCGTCGTCCGCAGACAGCTCCGACGGCGGGTGCAGGTGCGCCAGACACACAATTTCGTGGCCAAAGCGCA
CGCATTCCATCATAGCGTAGCAGCTGTCCTTTCCGCCGCTCACGAGCGCCACCACCTTCATCGCTAATGGATCTATCAACTGAGGGAAAACGCTAGTGAT
GCATTGATGCGTTGGTCGAGAAAACTGTAGCCATCTCAGCTAGGAGTGATGGTCGTTTCAATTGATGTGCACCACACCAGAGATGTTGTGATGTTGCGCC
TTTGCAGTCTCAATAGAGCGCCCCCTTTCACCGAGATGGCGACGGTGCGTTCCGTCCTGCTGAGCGACATCCAGAGCGTGCTGAGTCTCGCGAGACGGCG
TCATGGCTACTTGCTGTCCGGGACGAGCAACCCGCGCTCGAAGAAGGTGCGTAGGGGTTATGTTGGCTGCGTAATACTGGCTAAATTTGATCCATGTCCG
CTCATTAAATGTTCGATTACGGCTGCAGGAGAGTCCCTTAGTGGTCTTTCAGAGCTTCTCTCTACTCCGTGGGCGTCTGCTACGATGCGAGAGTAAGTTG
AAGTGCCTAATTCTCGTCCGAAGGCCCATTGATGACCCTTTTCGACATAATGTGGATAGATATGGCGGAAATATCGCCTGTGAACGTTGTGAAGCCATTC
CTGGATGTGATCCGCCATGAACATGCCAGTAGTACTGTAACTGGCGCAGCACTGCAGGCGGTGATGAATTTCCTACATTTCTGGCCCTGGGCAGACGTTA
AAGACCAAAATGCGGCCGCTGATGCCGTTTCGGACATTGTGGACGCTGTAAGCCACTGTCGCTTCCAGGAAACAGGCATCGAGAGCGACCAGAACGTGCT
GGTGCTGGTCGTGCACGTGCTTCACGCAGTGGTGCGCTCGCCTTGCGGATCCAGACTGTCGGACCACTCAATGTGGCAGTTGGTGGAATCGCTCTACGCT
CTCAGTCGGGGCAATCGACACGACGTACGTGGTTAATCAATTGCAGTTTTGCATGGATTAGTTGCTAAATGCTAATGGATCTGTTGTGTATTTGTACAGC
CACATATCACGCTGCCGTTGCGATCGACGGCAACGAACTTTCTGCATGACACTGTGGCGTTTATTTTTTCAAACTCAGCGATCTATTCGGCCTTGGCGCC
TGCTGTAGAACCTGCAACGCCCTCGTCGGAGCTTCTCAGACCCGGATTCGGACTGCCCTGCGCTGTCAAAATTGTGGGTTT