Description :
From Genome Similarity Track
Location :
Scaffold_1:2727436- 2728837
Transcript NameFunction/comments
Phyin_T30-4PITG_00518Nucleoredoxin%2C putative

Sequence
1401 bases(100 bases per row)
AGGGAGATGGTCTCGCCTTCTGCGTTCACGAAGACCAGCATGGGGATACCCGTGACGCCATACTTGGTGCTTATGGCCTGGTTGGCCGCGCGTTCGTCGA
AGGGCAAAGCCAGGAAGGGCATCTCGTTGTAATACTCGGCATACTGCGACGGATCGCGGTCGGACGAGATGAAGATGAGCTCGAACTCCGGGTGCTGCTC
GATCATGTCGTCATACACAGCGCTCAGGAAGGGCGTGAACTGGCGGCACGGGGGGCACCAGTGCGCACTGAAGTAGAAACCCACCACCTTCTTGCCGGCC
AGCTTGTTGTCCGTGTCCTGGAGACCGTCCTTTGTCTGGAGCTTAGCGCCGAGCTGTTCCGACCACTTCATTTTGTATTTAATACTCTTTCTTGGGGGTC
GACAGCGAGAATTATAGTGAGTGAAAAGTTGTGTGGGTATCCAAATGGTACTGTGACGGACAGAATATTATGAAATGAATTTTGACGAAGCACAAAAGTC
AAGTGCGAATTTCGCCACGTGGATCAATTTCGGCTTTCGGACTGGAAAAGAATGACTGAGCTTCGTAATCTTACCCCCCTACTGGAGTCTGGTGTCTGTC
TGTCAGTCCGTCCGTAACGGGCTAGGGTTAATTAATGTAACGCAAATACGCGCGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCTCCAATTGGCTAAA
ATCGCATTATGTGGTGTACATATTATATGTGGTATACACATCGTACTTAAAATGCACCGTTCAAATTTCATTTTGCCCCCATTTTCAAAACGGAAGCCGC
GGAACGCCACGTTACTCAAGGTACGCTGCGTGTATGCATGTTAGTTTGCATTAGTAGCTAGCAAGACACTCATACACAGATAGTCCGAGGTTCCTGGGGC
TGCTTAGGGGGTAGCTTATAACTTGCGGGATTCTATCCTGCAAGTAGGTAGCCGTGCTAAGGGGATTTAGTTCTAGAACCCTCTGGGTTCTTGGGGCTTC
ATCCCACCGCCCACTCTGCGCGAGAGCACATTTGGCACCTGGTCCATTGACCGCAAACCCGACAGCGAACCAGTTGAGCCGGTCGTTAATGGTTATTAAT
GGGCACGCACATTGCGTGCGTGCAGTTGGTCAGGAGGGGTACCGTAACTGGCCTCTTTTAACCGACAGATGGGATGGGGGCTGTAATAGCCTATCAATAA
CCAGCCTTTGCAATTAACGGCCGCCTTTTGGCAAAAGGATATCGCACCTCAAGCTACAGTACTATCCGGGGGCCCAACCCTGAAGATTCGACTGCACAAT
TTGCAAACTAAAACCGCTCCGGGCCTCACGGCCCGTGACTGTGGGATAAGTGATCGGAGATAACCTTGATGGGGGCAAGCAATCCCAGGTAGTACGCGTA
T