Description :
From Genome Similarity Track
Location :
Scaffold_207:27273- 32230
Sequence
4957 bases(100 bases per row)
GACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAA
ACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTGCTGCCATGTCGATGACGCTAACAGAACAG
CAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACG
TCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGG
TAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATTGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGG
GTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTT
GCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGG
AAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGAC
TATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTGCTGCCATA
TCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCG
GTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGT
TTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAG
TTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAG
CAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGT
CCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACAC
CCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCGAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGAT
ACGAATATGACTGCTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATAC
AGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGT
ACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTG
AAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAG
GCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATC
CTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTA
TTTCTTGATCGCTGGACACACCCATGACTCCTACACTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAA
TCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGG
TGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGG
CGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATC
GATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGT
TCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGC
CGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCT
TCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCGAACAGCGTGTGCTTTAT
GGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGA
CCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACC
GTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAA
GCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGT
AATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCACTAATCCATTTGCACGCATCAGGTGTA
TATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGC
ACATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACG
TCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGA
ACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAA
GACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTG
TGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGA
AGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCC
ATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGA
CCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTT
CGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGC
CATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAG
CGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGG
GCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTTGTCAGCTCG
CCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGC
ACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGAC