Description :
From Genome Similarity Track
Location :
contig_4:272727- 274134
Transcript NameFunction/comments
g1349.t1hypothetical protein

Sequence
1407 bases(100 bases per row)
TGCGATATTTGCAGCAGGAGCTGCAGCTTCTTCGTCTTCGAGCATGAGATCTTGCCAGTCGTTCTCCAGCAGCCACGCAGAGGCCACCGCCACGCTCTGG
TCGCAGATCTCCAGCTGCGAGCGAAATGAAACGAAGTGAGCACAAGCCACCACCGCTCTGGATATGCAGCATGCAACTAAGATCTTACCACGCGCAGAAG
CGCCTCGGTCGGCACCGTGGGGAATACTCCGCGGAGCGTCTCCATGGCTCAGGAATCTCTCTTGGGATTTCAAGATTGGGCGGTAATAGTACGCTAGTAC
TACTAGTAATAGTATAGTACTTGCTAATACTAGAAAGTCGCATTGAGCCCAGCATTTATACGCGAGCAAGAGGGCGTGGCAAGTTGCCATTGGCAACGGC
GTCCAGCCAAGCGGAGTACATGCGAGACACGTTAGCAAGGAGAATAATGACGCAGGCATTGAGCCTCATGCGTGCTTAGATAAAAAACACTACTGTGTAT
TGTTCAAGTACTAATATATGTACGAACATCGGGGACTGTCGATGGCAAAGTCGTTTTCGAGATGAACGGGGACAAAATCGAAGCGCCTAGATTGCATTTA
ATCACGCTCACGATGTTGAGCGGGCCCGATATGTTTAGCGTGGTTCTCGACAGTAGCAGCAATGTCCTTGGCCACGTCATTTCAAGCTCCGTAGCATCCT
CCACGAAGTTGGTGGTCCCAACGCTGTCCGAAGACACAGCAACAATCTGGTTCAGAACATTGTCCAGCAAGTTGCTGGCAGCAACTCCTTGCAACATTCA
TGGTAGTACATAACCACCGGTAGCGAACACGCTCCGCAAACTCGCAGGCGGCATCATCGTTCGTTAGCTCTTTCCACGCCGGCTAAGGTAAGCATCAGCG
ACGGGAACTTGAAACCAAGGCGGGCATTTTGCGTAATAAATTACCAATTAAATTACTTGCAGTTGCATGCTACGTGGAAAATGCAACTGGTATTCATACT
CCTTTTTTGTTGTTGAGAATTCGATAACTTAGGTGGATTTCGTGGGAGGGCTTCAGCTCAGTTTTAAATGGCCTTTTATTTGAGTTTTTGTTACTGTCCT
ACAGAAGCAGTAACCACACAAGTACTGGAGCCTACCGAGAAGCTTTTCTGGGAGGGTACACATCAAATTGTGTTGAAAAGCACCACGTCGCGATCCGAGT
AAAACACCAAATGAGTTTTCACGTGTCAGCAGTTTCCTATCTTTGACGACGAGTCTTTCAGCTCGCGAGCGACTCTTCAAGAAGTCGCGCTTTCGTAATG
CCATCGGCGGTCAATGGCCAACAAAGATTTGGCTGCGAGAGCTTGCACTCATTGCTTCACTTTTTCTTTTGAGCGTGGCTAGCGACCCAGTTGTATCATC
AGTTTAC