Description :
From Genome Similarity Track
Location :
Scaffold_453:27272- 28937
Transcript NameFunction/comments
Phypl_g8484hypothetical protein

Sequence
1665 bases(100 bases per row)
CTATAAATATATCcagtcttacttttaccTACTCGGTACTTTgtccccttcaggccagAGACTTGTGAAccgttcactgggagtttaTATACTCTCGAAG
CACACTTCTTCTCGCAAGGTGCTGTGTGACCCTGTCACACTTGGTAGCACTTGTAGTCAATCTACGCCTACGCGGATATATTGATTACCTGAATCCTCTG
TGGACTCAAGAAGCAAGCCACGATGGAACGCAGCGAGGTTCCTCACTAGAACAACTCCCAGTGGGAGTCGGTTCGAAAGATGGGAGACATCTTTGGGTTG
GAAGCCTTGTGGAGTTTggcggctgcgacgccagGCGAATAGGTCGCTCGCGTGAACGCGTTCGACACGTATGAATGTGGACTGATTGCCCACATTTAGG
GTAGACTACAAGCACCCGCGGCTCAATCCAAGCCTCCTGGACTGAAGCCTCTACGGCTGACGGTCGTTGTCTTCGAAGGCAAGCAACGAGAGAACCTTCA
CTTCTGGGTCCGAGAAGTAGTGATCGCGATGGGCGCAAGTCTCATCTTGAACAGGTGCCTTTGCGTCGCTTTCGCGCTTTCGAAGTTTGGCGGTAGAGCC
AAAAGTTAGGCCTACACCATGGAGACTACGTCTCCAGGATGTGGAACATCCTGGACGCAGTTGATCGAGCAACTGCGTGCCGATTTTCTACCGGTGAACA
TCTAGTATTGCCAGCGGTCACGCTTCCTTGCCTACAAGCAAGGGAGGCGGGATTTGCACGAGTACGTGCAGGAGATGCGTGTCTTGTCAGCATCTCTGGT
AGGAAACCCCTTACCCGAAGACATCAAGGTCACCGTCTTCATGGAAGACTCTCGTGTAGACCCGGCACGCACACAGCTGTTTCGTGTGCATACAGAGGCC
GCGCCCAAGGGGACAGGGGAACGTAGGACACCAGTAGGAGCGGGGCGCCCTACTGGGGAATATCTGAGTCTTCACGACAGGTGTGCGGGTAGCGCGCACC
GTGAAGGCTTATCCCCTGAGAGGCTATGCTCTATCGAATCGGAGAAGGGCATCGGAGGGCTGCTGATAGTACACGCGAGTGTTCGGGGATACGGATTTTC
CTCGAGAATCTTAATTGAATCTGGGGCGTCTAGGAACTTTGCTAGATGCCGAAGTGTCACGAGGAATAGCGACAAGTTCTCCACTGCGTGAGAGCGCGGG
GAAGGGGCTGATCTTGGTGAGACTGGCCGCAGGAACCATCGTGAAGGTGCCCAAGATCTGCATCGAGCTGTCGGTCAAGTTTGAGGACTTTGACAACTCG
GAGCCGTTCATTGTCCTGGACATGGACAAGTACGACTTGACCGTCGGCATGCCGTGGCTTGAGAAGCACGAGCCGTGGATCGACTGGCGAGGAAAACCCG
AAGGAGCTAGTAAGCCATCCGTCTCTGACAGAGCTTTGGTGAGTCATATTCCCACCTCTGTCAGGCGACAGGACACCAAGCGGGGTGTCCGGGGCGTATA
GACGCCAGAAGAAGACATGAGAGTCGTCACAGCGACAGACGCTCCCCGGGAAGGAGTTGCGCGAGACACCGCAACAGGTCGTGAGACCTCGTTCACTGCG
AGCAGAGCTCGTGGGCCACAGAAGGCTAGGTAAGTGGACACGAATTTCCGCCCCGCGCTGGATAC