Description :
From Genome Similarity Track
Location :
contig_62:272717- 275477
Transcript NameFunction/comments
g9251.t1phospholipid-transporting ATPase, putative
g9252.t1hypothetical protein

Sequence
2760 bases(100 bases per row)
GTGTATTTCAACTACGCGCCGGGCAACGCGACGTTCGACAAGTGCTCGAACGTGGTGGTGACGTCCAAGTACTCGCTCGTGACCTTCCTGCCCAAGTTTC
TGAAGGAGAGCTTCAGTAAAGTGGCCAACTTCTTCTTCCTCATGGTGTGCGTGCTGCAGAGCATCCCGAGCATCAGCAACACGTACGGCTACCCGACGAA
CGCGCCCGTGCTCTTCTTTGTGATCTCTATCGACGCCGTGTTCGCCGTCATGGAGGACATGCGCCGCCACAAGTCGGACAACGAGGCCAACTCGGCCACG
TGCCACGTGGTTCAGGACGGACACGTCGTGGACAGGAAGTGGTCGGACATTAAGGTGGGAGACTTTTTGCAGATCAAAAACCGAGAGGTCATCCCCGCCG
ACGTGCTCGTGTTGGCTGTGGCGGAGCCTGTGGGCGAACCGCCCAGCGGCATTTGCTACGTCGAGACCAAGAGTCTGGACGGAGAGACGAACCTCAAGCT
GCGCCAGGCGGTGGCGGCGACCATGAGCTCGCTGGCGAACGCGGCCGAGCTGTCCTCGCTGCGCGGCGTCGTCAAGTGCGAGCAGCCCAACCCGCACATT
AACAAGTTTGCAGGCAAAGTGGAGGTTACAGTGGGGGACGGCTGCGGCGTTGAGGTGATGCCGCTGTCAGTTAAGAACGTGCTGCTACGCGGTTGCAACC
TGCGCAACACGGACTGGGTGTTTGCACTGGTGCTCAACACAGGCATCGACACGAAGATCATGCAGAGTTCCAGCGCCGCCCCGTCCAAGTGGAGCGACCT
CATGCTCAACATCAACCGGATGATTGTCATTCTGTGCATCGGGCTCTTCGTGGCCTGTGCCGTGGCTGCTACGTGCTACATCACGTGGCAGTACGACATC
GTGCGGAACACGTGGTACATCCAGCTGTCCGAAACGGAGAGGAACCGCACGCGCTTCGTAGCGTTCATCCAGATGATGTTCTACTACTTCTTGCTGCTGT
ACCAGGTCATTCCGATCTCGTTGTACGTGTCCATGACGAGTGTCAAGTTCCTGCAGTCTCGTTTCATGTCGTGGGATCTGGAGATGTACCACGCCGAGAC
GGACACCCCCGCTATCGTACGGACGATGGAGCTGAACGAAGAGCTGGGTCAGATCTCGTACGTCTTCAGTGACAAGACGGGAACGCTGACGTGCAACATC
ATGGAGTTCCGCAAGTGCTCCATCAATGGAATTTCGTACGGCTCCGGTATCACGGAAATCGGACGCGCTGCGCTGGTTCGCGCGGGAAAGCCCATTCCAC
CGGAGCCCAAGCTGGACCCGAGCATCAAGACGATCCCGTTTGTAAACTTCGTCGACAAGGCACTCTTTGACGGAATGAAAGGCAGCGCAGGCGAGGAGCA
AAAGGAGAAGATCCTGCAATTCTTCGAGCACCTCGCTGTGTGCCATACAGTGATCCCCGAGAAACTCGAGTCTGGTGAAGTCCGGCTATCAGCGTCGTCT
CCTGACGAGCAAGCCCTGGTGGCTGGTGCTGCCTTCGCAGGGTTTAAGTTTGAAAGCCGTAGCGTGGGGACAGCGAACGTGGAGGTCATGGGCCAGCGCG
TGACCTACGAAGTGCTGGACGTGCTCGAATTTAACAGTACGAGAAAGCGTATGTCTGTGGTGGTGCGCAAGCCGGACGGAGAGCTGCTGCTTTACACGAA
GGGAGCCGACATGATGATTTATCAGCGCCTGAAGGATAACCCAGCGATGCAGAAGATCAAGAACATCACACGCGACCACATGGAGAAGTACGCCTAGCGA
TGGCTTGCGTACTCTTGCTCTCGCGATGAAGAAACTTGACGAACGCTGGTTCAACAGTGGAAGATGCGCTTCGATGATGCGCAAGGCAACGTGGCGGAGC
TCGACCGACGCAAAGATGGCAAACCCAATGCAATCGACGTCATGGAAGAAATGGAGGGGGCTTGGAGCTGATTGGCGCAACGGCGATCGAAGACAAGCTG
CAAGATGGTGTGCCGCAGTGTCTCGCAAACTGACGCGTGCTGGAATCAAGGTCTGGATGCTTACGGGCGACAAGGAGGAGACTGCGATTACATCTCGTAT
GCTTGCTCGTGCCTGGACAACTCGATCCAGCAAGTCATCGTTAACGCGACCACATGCCCGGAGGCGACGATCCGAGCCAAATTGAATGCTGCGGCCCGGG
AGTTCATGGAAAACGCGAAGGGTATGGCAGGTGGGGCGAGAAGGAAATCTCGCTGATCATCGACGGCGAGGCTCTTGAAATGGCCTCAAGCCTGGAATGC
GCGCACCTCCTGTCGTTTGCCAAACTGTGTCGCGCGGTGATTTGCAACGTGTATCTCGGCCCAGAGGCGGAGATGGTGAAGCTGGTCCGAGATAACATCA
CACGGTCCGTACGTTGCTATCGGCGATGTGCTAACGACGTTGCCATGATCCAAGCCGCGCATGTCGGCGTGGGTATCTCTGGACAGGAAGGATGCAAGCT
GTGAACTCGAGTGACTACGCCATTGCGCAGTTCCGCTTCCTTGAGCGGCTGCTTTTGGTTCACGGACGGTGGAACTACATTCGTATCTCCAAGCTGGTGC
TGTACATGTTCTACAAGAACATCACGCTCGTGGCGCAGTACTGGTACGGCTACCTCTCGGGTGCTTCTGGCTCCAAGATGTACTGGGAAATCGGTGTCCA
GCTTTACAACGTGGCTTTCACGGGTCTTCCGTCGTGGTCGTGGGCGTGATGGACAAGGAC