Description :
From Genome Similarity Track
Location :
Scaffold_1445:2727- 3896
Sequence
1169 bases(100 bases per row)
AGGATCTTCAGAAGAAGGCCAAGCGCGCGCGCTCTGCCGAACAAACCAGGAAGTGGAGAGAGCTGTCCGAACGACTGAAGGCAGGATTCGCAGCCGGTGA
TGCTGTGTGGCTGTATATACCCAAAGTGCAGCCCGGGCTGAGCCGCAAACTGGCTCACATGTGGCATGGCTCCTTCAGAATTCAGGAAATCCATGACAAC
TTCCGCGTGAAACTCAGGGTCAAGAACACAGGATATCGCGTGAATCCCTGGGTACACGTGAGCCGTTTGAAACCCAGAGCACTATTCTCGAAGCGGCCCA
CTGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTATTGCCTGAAGACAGTTGGGAGCCCAACGCTGCGAACGATGAGTACGAAGTTGA
GCGAATCCTGGATTTGCGATGGACTAAACGGACTCGGACAGCGAGACGAATTCGTGAGTACCTTGTGAAGTGGAAGGGGTATGATGAGACCGAGTGGCTG
CCTGTGTCGAAGCTCAACTGTGGTGCCCTGCTCTACGAATTCAATCAAGACGCAAGAGCGCGGGCCCGTTTCCAGGCCATGCAGGCTGGAGATGATCACC
CAGGATTCTAGCACTCTGGGGTGACAATGACCCAGAGTTACACGTGATATTCAGGGGAAACTCTGGGTGACACTGTGAAACTCTGGGGAAAATCGACGGA
ATGTGTGAATATTGGAGACGGAAAGCGTGAATGTGATTTGACTTGATTTGATTATGGAGAAGGTGATACTGCTGAGGCTTTGGCAGTGTGTGAGAAGGAA
GATGAAGGCGGCGAGCTTTACAAGGACATGGAGACAGTAAACGAAGTTGGATGACCCAGAGAACAAGTCAGAAAATGATGAATTTCTGGGGAAGACATTG
AAATCGAGATGAAATCCTGGGTATTATGGAGAGTTACGCTACGACATGTGAAATTCAGGTGGTTCTCGGGATTTGGAGGTGACCTTGACTCTCACGAGTG
CTTGAGAGACAGCGGGTTGAGCTTGCGGATGGCCAGGGGCTTGATGTGGCGCTTGATGTTGTTCGGCACGTATTGTAGCCACTCATCGTCGTCAGCCGCC
GTGTTCCATTGGACTCGAGCAGGCTCACGAATGTCCAACGTCGCTAGCTGGACGTCTAAGTCCTTGCAC